Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11520  (registered. 2007)
Contig Information
Length 1035 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_dL Crown of seedling 3
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0255200 [Oryza sativa (japonica cultivar-group)] >gi|50251667|dbj|BAD29691.1| putative 40S ribosomal protein S15A [Oryza sativa Japonica Group] >gi|113535993|dbj|BAF08376.1| Os02g0255200 [Oryza sativa (japonica cultivar-group)] >gi|125538846|gb|EAY85241.1| hypothetical protein OsI_06614 [Oryza sativa Indica Group] >gi|125581523|gb|EAZ22454.1| hypothetical protein OsJ_005937 [Oryza sativa (japonica cultivar-group)] >gi|215768335|dbj|BAH00564.1| unnamed protein product [Oryza sativa Japonica Group]
Score 621
Evalue 1.48058e-62
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig11520
aagatcgtagATGCTCAAACTAGAGCTTtaatcGTGTATCTCGAAGTACATGGGTGTATTACACCTACAGAAATACCTGTCCCAAAGAAGGATTACAATA
TTTATGTCAGTGTTGCGAGACATACTTCTGAGATGTAATCGCattttttgCTGGCCATGAACAAAAGCAGCAAGCTCTAAATGtccaaatAAAATGACTT
CAGTCATCATAACAGAAAGataaacAATGCAACCCAGAGCTGACTCAGCATGGGATAACTGTGTTTTCCTTCTCAATGGAAGTAACCGAGGACCTGGCCA
CCCACATTCTGCCTAATTGCTTCCTCGTGATCTAAAACGCCATTTGGGGTGGTCACCACAACATAGCCCCACTGCCGTGTTGGAAGCATCCTAGTTCTGT
ATTTTTCTATTTCCGTAGCTCTGAGGTCCTGCCTGTAAGTGAGAGCTTTGCAATCTTTAATCCTTCCCTGAAGTTCCACGGTGATTTTTCCAACCCTATG
TGGATCAAAGACCTCGAAATTTTTTATGTAACCTCGGTGCTTCATGATGTTGAGGAAGGAGATCATGACGCCGGAGATGGGCT*GGAGTTGCGCCGTCGC
CTTCCCCCGCCGCTCCGCGTTCACCATCGTGCGCAGCGCGTCGTTGAGGATCCTCCGCCCCATCGCTCGCTTGATCTCTCCACTTGTAGCCCGCTGCACC
TCTCGGCTCGCCTCTCTACCAGCCGCCACCGGTGCTCGCTATGAAGAAGAGACGGGTGGGAATCGGGGAGGACGCAACGAGCATTAGAAGTGGGCCTTGC
TCGCTCGATGATTTCCTTAGGAGAGgaagggtGTGCTTCGCCTGAGTAGCACCTACACCCATgcc*ttgttcCACTTGTAtccggcggcgcaggagatgg
atcgggggagaggtccggcggcgcaggatgtggagcgagggagagggccggcggcgcacctgagagggagggagagaggaagagggccggcagncggcgc
acctgtagtgggagaaaggaggtagagtcgagccc
page-top