Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11481  (registered. 2007)
Contig Information
Length 1275 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0721200 [Oryza sativa (japonica cultivar-group)] >gi|113549573|dbj|BAF13016.1| Os03g0721200 [Oryza sativa (japonica cultivar-group)]
Score 1623
Evalue 1.31249e-178
Total Hit Count 281
Registered year 2007
Contig Sequence     [ Download ]
>Contig11481
aactatcctcccgacattgatacttgctatggatgatgaagatgtggatgtacaaagcacagccaaaaaggctgctgaaaccattgtgttggttattgat
gatgaaggagttgagacattaatacctgaacttctgagaggagtcaatgacaatcaggcatctatgagacggggcgcagcctaccttattggtttcctct
tcaaaaatagtaaattgtatttggctgatgaagctccagatatgatgtctaccctaattactttgttgagcgatactgataacgctactgtattggctgc
ttgggaagcattttcaagagttgttggctctgttccaaaggaacagctcCCTACACATATAAAATTAGTGCGTGACGctgtCTCTACAGCCAGAGATAAA
GAACGTAGGAGGAGAAAGGGTGTGCCTGTTCTCCTACCTGGATTATGTCTTCCTAAAGCACTGCAGCCATTTCTTCCTATATTTCAGCAGGGTTTAATTA
GTGGGTCGGCCGAGACAAAGGAGCAGGCAGCAGAAGGTCTGGGAGAGTTAATTGATGTTACAAGCGAGAAAACACTTAGGGAAGTCGTCGTGCCAATTAC
AGGACCTCTTATACGCATCCTGGGAGACCGATTTCCATGGCAAGTTAAGTCAGCTATCCTATCAACCCTGACTATTATCATCGCAAAAGGTGGTCTTGCA
CTTAAGCCCTTCCTTCCACAACTTCAGACAACATTTGTTAAATGTCTACAAGATAGCAACAGATCTGTCCGCACGAGGGCCGCATCAGCTCTTGGAAAGC
TTAGCGCATTAAGCACAAGAATTGATCCTTTAGTTAGCGATCTTTTGTCCATGTTGCAGTCAGGAGATGACGCTGTTAAGGAAAGTGTGCTGTCTGCACT
TAAAGGTGTTGTTAGGCATGCTGGCAAAAGTGTTAGCTCTGCAATCAGATCACGTGGGTGTACTCTTCTCAAAGATTTGCTGCAGGCTGATGCTGATGAT
GTCCGCAGTTCTGCTGCAAAAGCAATTGGTACATTATCTCAGTACATGGATGAGaccgagaccaccgatctggtgcagaccctgttgagcatgggcacat
taccagactggtgtaccagacatggtgctttgttaacattctcttccatatcaaggcattgtccaacaaaactgtgccattcaacatcatttccatctat
tgttgatcttctgaaagattcgctaaaagatgacaagttccctggttcgtgaagcctctacgaaaactctgggga
page-top