Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9033  (registered. 2012)
Contig Information
Length 781 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 1
Wh_r Root 3
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226532698|ref|NP_001145913.1|| hypothetical protein LOC100279432 [Zea mays]
Score 308
Evalue 6.00E-82
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9033
TTTTTTTTTTGTAAAACAAACATGCATAAATATCAATGAGCACTCGAAGCTTGCACAATCCAATAACCTCAGGTGATGCCAAAAGGGATCACCCACAGTG
TTCCACGCACACCCAACCGCATCAGAAGCAACTCATGGCATATTACATAAGTACAGAATTCTCTAACACTCGCAGTACCATAACACAACCGGGAAAACCC
AACATAGCTCAAAGCTGAATAGGCTTGATCTTAAAGTGGAGGTTGATAAGTGAAAACACGAAACATTTAAGGTCCTGGACGAGGTAGTAGAAGATGCGGA
GGCCCTCCGGGTCCTTGCTGGTCTGGACGTCAACGAGGGAGCCGATCTTGGAGGTGGTGAAGGAGATGTGCTCGTTGCCCATGACAATCTCGAGCTCCTG
CCTGCCGACGCGGTCGGGCTCCGGCCAGTTGCTGTCGTCCTCCTTCATTATCTCCGAGTCCTGGATGATCCTCCTGGCCTCGCGGAGCACGGAGGGGGAG
ACGAAGACCTCCTTGCGGATCATGGTGTCGTTCTTGTAGTTGGAGTTGTTGGCGTAGCGGAGCTTGCCGTCGGGGCGGAACTCGAACTCGAGGAACTCGT
GCCCGAACTTGCCCTTGTGCCCCACGTAGTACCGCAGGTAGAACTCGGCCCCACCTGCCTCCTCGCCGGCTCCGTTGCCCGCGCCGCCGACCGCCGCCAT
GGTTTTCTCTCTCTTCGTGGGGGCGGAGAGGTTGCAGCGCCGCTATGTTCGTGCTCGGCACTTCGTCTGCCTCGTGCCGAA
page-top