Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11470  (registered. 2007)
Contig Information
Length 1028 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)] >gi|215715385|dbj|BAG95136.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215741116|dbj|BAG97611.1| unnamed protein product [Oryza sativa Japonica Group]
Score 351
Evalue 2.99652e-31
Total Hit Count 32
Registered year 2007
Contig Sequence     [ Download ]
>Contig11470
acgagggaatggtcccacggctgtctccgtccatgcgggtggcagtattaccattatgctcgctctcagccacgCTGAGCGCATGGCATACGTATCCACT
GGTGACAAG*CACTGGACTCACACAAGCTGGATAATGAGTGGCATGAGGACAGCACTACCATTCCTTGGCAGCCTCTACATGGTGAGGAGCTCGAAAAAC
AAACCCTCACAAATCATGCGCGTCGATCCACCAGATAGCTCCAGTTCCTCCTCGTGGTCGTCTACACCACCGCAAATGATCGCCACATGTCCAGCTAATC
AGATGGTTAAGCCTTATCTGGTGGAGTGCAATTCTGAACTTCTTCTGGTTGTCTATACCGACAGAAAGTCCCGGCTTGTGGTTATTCGGCTTGCTGACCT
CCTGCTTGGAGTACCTGCCACGCCATTGACAAGCATCGGTGACCACGCCCTCTTCATTGGCACTTGGAGCATGGCCGTCAACTCCACCAACCTACCATCC
GTTCAGGGGAACTCCATCACTGTCCTCATCCCACGTAAGAGTGGCCGACTGCGGCAATATGATCTGCGCACAGGTACCTGGTCGCTACTGTGTGATGGAT
ACTTCCTCAATGCTAACGGCCCCATACCAAGGCCATACAGTCTTGTCCACCACATTGTCAGTTGTTGCCAGCGTCTTTACTGGCTCAGTGGACACATTTG
GACCCTCTACCATCGTTCTCAACCTTGTTGGACTATAGTCGCTTTAGCACATAGAAATGTTTGTGCAGTCTGCAGTGATCAGTTGAAGGCTATTCATCTT
TCCAATATCTATGTTTGAACGTCTCTGCTTTGGCCACATAAGGTTTGGGATGTATTTGGCTGTGTGTTTGCCTCTACAGTGTGTCTACTTTTGTTAAGAT
ATTTCAGTCTAACTCGGATGAATTCAGAAATATTCTCCCTTTGAACTGTGTTGAGCCTTTTATCATTCTGTCGTTCAACTGGTGAACACTGCTTTTTTTT
ATGTAGCTTCTGCCtggacTTAAAActt
page-top