Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11449  (registered. 2007)
Contig Information
Length 881 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit SAL1 [Hordeum vulgare subsp. vulgare]
Score 768
Evalue 1.03368e-79
Total Hit Count 216
Registered year 2007
Contig Sequence     [ Download ]
>Contig11449
gaggaattcggacgaggcaccatcccccggaaccgaaaccctagccgcggcggcggcggcgATGGGCAACCCGGAGAAGCTGATGGCGCAGATCTTCGAC
CTCAAGTTCACGTCCAAGTCGCTGCAGCGGCAGGCGCGCAAGTGCGAGAAGGAGGAGAAGGAGCAGAAGCTCAAGGTGAAGAAGGCCATCGAGAAGGGCA
ACGTGGACGGCGCCCGGATCTACGCCGAGAACGCCATCCGCAAGCGCACCGAGCACATGAACTACCTCCGCCTCGCCTCCCGCCTCGACGCCGTCGTCGC
GCGCCTCGACACGCAGGCCAAGATGCAGGCCATCGGCAAGTCCATGGGCAGCATCGTCAAGTCGCTCGACTCCTCCCTCGCCACGGGCAACCTCCAGAAG
ATGTCCGAGACCATGGACAGCTTCGAGCGCCAGTTCGTCAACATGGAGGTCCAGGCCGAGTTCATGGAGGGCGCCATGGCCGGCTCCACCTCCCTCTCCA
CGCCCGAGACCGAGGTCAACTCCCTCATGCAGCAGGTCGCCGACGACTACGGCCTCGAGGTCTCCGTCGGCCTCCCCCAGGCCGCAGCCCACGCCATCCC
GGCCGCCAAGGACAAGGAGAAGGTCGACGAGGACGACCTCACCCGCCGCCTCGCCGAGCTCAAGGCCCGCGGCTGAACGACGGCTTTTTCACTTCACTTC
ACTTCAGGTACGGCTCATGCAATGTTCACTCGCTTCGCCGTCAGTTGTCAAGGGCTGCTCATATCTGACAGCCCCGTAAATATTGTTAACGCCCATGTGG
GTGCTCTCTTGCCTGGGATCTCTATGTGGAACTGATTTAAACACTGCTGTGTGATATGACGTGTTATTCCGAAACGGAGtg
page-top