Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11429  (registered. 2007)
Contig Information
Length 568 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0274700 [Oryza sativa (japonica cultivar-group)] >gi|34395050|dbj|BAC84633.1| putative B12D protein [Oryza sativa Japonica Group] >gi|50508850|dbj|BAD31625.1| putative B12D protein [Oryza sativa Japonica Group] >gi|113610896|dbj|BAF21274.1| Os07g0274700 [Oryza sativa (japonica cultivar-group)] >gi|125557945|gb|EAZ03481.1| hypothetical protein OsI_25619 [Oryza sativa Indica Group] >gi|125599817|gb|EAZ39393.1| hypothetical protein OsJ_022876 [Oryza sativa (japonica cultivar-group)] >gi|215769366|dbj|BAH01595.1| unnamed protein product [Oryza sativa Japonica Group]
Score 362
Evalue 4.82785e-33
Total Hit Count 44
Registered year 2007
Contig Sequence     [ Download ]
>Contig11429
ccggtgggagcaaggaagcgagcgagatccacctaacccaccaatggcggccgcTGCTTCCTCCAGCGCGTGGAAGGCCAGGTGGCTCCGCCCCGAGGCG
TACCCGATCTTCGCGGCGACGGGCGTGGCCGTGGGGATCTGCGTGATGCAGCTGGTGCGCAACATCACCACCAACCCCGAGGTGCGGGTGACCAAGGAGA
ACCGGGCGGCCGGGGTGCTGGACAACCACGACGAGGGCCGCCGCTACGCGCGCCACCCCTTCAGGAGGTTCATCGACGGCAAGTCCGCCGAGATCATGCC
CGGCATCAACAGCTTCTTCACCGACCCACCAAAGAACTAGACGACGTCGTCGTCGTCGGAGAGCTCTTGTCCAAGGAAGGAAGGAATTCCTCCGCGAGAT
TTTTTTTCCCTTCTGAAGGAATACAGAAATACT*GTTGTTATTTTTCCTCGAATTCAAGTATATTATTCGCCATGACTAATTGTC*TGGCTGTACACTAT
TGATT*CTTGTG*ATCATACACACAAACCTTAATCCGAATAATGCCTATGTCTTgaagaaaaaaaaaa
page-top