Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9028  (registered. 2012)
Contig Information
Length 941 bp
Clones alternative view 119 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 12
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 3
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 13
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 3
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 7
WH_XA Root 5
WH_XB Root 11
WH_XC Root, treated at 50 microM Al for 6h 11
WH_XD Root, treated at 50 microM Al for 6h 5
WH_F/WH_R 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|22204124|gb|AAM92710.1|| putative 40S ribosomal protein S3 [Triticum aestivum]
Score 441
Evalue 4.00E-122
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9028
TTTTTTTTTTAGCAACAAACTAGCTGGGCAGAATCAATCCAAACAAAGGTTTCTGGCATACATAAGTAACTTGTCTCGGCAAAACTTAGTTTAAACGAAA
TTAACATAGAAGCATTACACAGAAACTTTTGTCCATTAAAAGGTAAGGTAGGTAACCAAGCGTTGCATAGCCCTCGCTTATCACAGGGATAGAAAAGTAG
CTAGGACCAAAATGATGTGCCGTTTCATGGTCTGCTTGCTCTATTGGGACTTTAGACCTCAACCAAAGCCGGTGGGCGCAGCTCGTCCTCCTCCTTCGGG
GGGTGGATGGTGACAAGGTCAGGCAGCGGGGTGGTAGGGCCAAGCTTGCCCTTGGGGTCCCAGTCAAGCATAATCTTCACCTTGATACCAAGAACGCCCT
GTCTGAGAAGAACGTGCCTAACTGCAGCATCAATGTACTCGTTAACGGGCTGACCAGATGAGATCATGTACCCGTCCTTGAACTTCATCGACTTGGCTCT
CTGGGCCCTGAGCTTGCCGCTCACAATGACCTCACAACCCTTAGCACCACTCTCCATAACAAAGCGAAGAACACCATAGCATGCCCTGCGGACGGCAAGG
CCACCGAGGAGCTTGTAGCGGAGTGACTCGGCCTGGGCGATGGCGCAGAGGCCACGGTTGACGACCTTCTCGGCGTAAAGTTCAACGCCGTTCTCCGGGA
AGTTGAAGCGCTTCTGGACGACGGAGGTGAGCTCCCTGATCCTGCGGCCCTTCTCACCAAGCACGTTCTGCGTCCGCGTGGCCCTGATGATGATCTCCGT
GCGCATCGGCGTCACGCGTACCTCCACGCCGGAGTAGCCGTCCTCGGCAAGCTCCCGGGTCAGCATCTCGTTCAGCTCGGCGTAGAAAACGCCATCGCTC
ACAAACTTCTTCTTCTTGCTGATCTGGGTCGCCATGGTTGC
page-top