Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11409  (registered. 2007)
Contig Information
Length 1034 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit charged multivesicular body protein 2a [Zea mays]
Score 825
Evalue 3.27551e-86
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig11409
tgccttgctgacgaatcaactaacccaccaaaaccaatccgcgtcaacagctcaacactcatctcctctgcgccgtatctaatcctccaccatccgACGC
GCAag*aagAGGGAGGGGAACATCCAGATCGATCCGTGGGACTCACAGTCCAGCCCAATCCAAGCAGCCGGCCGGCCGGATCCGACCTCCGCCCGCCGCC
ATGAGCTTCCTCTTCGGCAAGCGGAAGACCCCAGCTGAGCTGCTGCGGGAGAACAAACGTATGCTAGATAAGTCCATCAGGGAGATCGAGAGGGAGAGGC
AGGGCCTGCAGACTCAGGAGAAGAAGCTCATCGCTGAGATCAAGAAGGTGGCCAAGCAAGGACAGATGGGAGCTGTAAAAGTTATGGCCAAGGACCTTAT
TCGCACAAGGCATCAGATCACGAAATTTT*ATGCCCTGAAGTCCCAGTTGCAAGGTGTATCTCTTCGTATTCAGACCCTGAAATCAACACAAGCAATGGG
AGAAGCCATGAAGGGCGTCACAAAA*GCCATGTCACAGATGAACAGGCAGATGAATCTACCAGCACTCCAGAAGATAATGCGGGACTTTGAGATGCAAAA
TGAGAAGATGGAAATGGTCAGCGAGGTTATGGGTGATGCCATCGACGATGCCTTGGAGGGTGATGAGGAGGAGGAAGAAACAGAAGAGCTAGTTAGCCAG
GTCCTCGATGAAATCGGCATCGACATCAACTCTGAGCTTGTCAAGGCCCCGGCTACCGCAGTCGCCATGCCGGTTGCAGCGGGAAAAGCGCCTGTTCAAG
CTGAAGCTGCGGGCGGGATGGACGGTGGAATAGATGATGACTTGCAGGCACGGCTTGATAACCTGAGGAAGATGTGAGCACTGGACTCTGACGGATTGTC
CACGCCCGCAATTCTCTGCCTGTAGTTTTGTACCATAAATGCCACTCCGGCAAATCTatt*acGTATCATTTGCAGTGTGTTTGGcattgacCATCTGTA
TATAGACatatcatcatattttcaataaatcaca
page-top