Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11308  (registered. 2007)
Contig Information
Length 699 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_e Seed DPA10 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0543200 [Oryza sativa (japonica cultivar-group)] >gi|38345947|emb|CAE04271.2| OSJNBb0103I08.18 [Oryza sativa (japonica cultivar-group)] >gi|38345949|emb|CAE04337.2| OSJNBb0038F03.1 [Oryza sativa (japonica cultivar-group)] >gi|113565024|dbj|BAF15367.1| Os04g0543200 [Oryza sativa (japonica cultivar-group)] >gi|215678877|dbj|BAG95314.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215717042|dbj|BAG95405.1| unnamed protein product [Oryza sativa Japonica Group]
Score 442
Evalue 4.17832e-42
Total Hit Count 114
Registered year 2007
Contig Sequence     [ Download ]
>Contig11308
acTTATTGAAATACTCCATATCTCTCAATGTTATAGAAACACTGGAA*GTAAACATGT*CA*ACACACCATGGCTGGCTAGTTCACAACTCTTGACCAAC
TAAAGCAAAGCCTTACATTAAATAAACATGCCGGAACATCCACAAGACTACTGCTTCAACCAACTCGATGTTCCT*GGCTCCTTCAGACATGCCTTATTG
ATTGCCCACACTTGCCACTTGTCCAGATCCATAGGCCTTAAGTTAAGTAGCTCCATACAATCCATGGCCTACACCAACCTCCTATGATGCCACATCTTAG
TAGTACGAACTGGAACCACTGCCGCCAAAGTAGCCACTGCTGctacccgtgtttcgACCCGAGTAATGCGATGAATATGAActcccgccaACATCAGATC
CACGAGGCATGTAGTCTGCACTGTAATTTGAAGAGtaatttcCACCAGCATCTCCAGTGCTCGCAGAACCTCCATAACTCAAGCCATGGCGGCTGCTGCT
ATACACCGGGTCATGACCAGCAACAGATCTGCTGCTACTGTATCCCACATGTGACCGCCCAAGCCTCTCAGTATAAGCATCTGCATACCGAGCACTGCTA
CCACCAACATCATAATCTAAGCGTGCCTTGGGCTGACGAACGCTAATGTCGTgataCCGAGGAGGCACGTCATCCATCTcaacatatgagcgttttgaa
page-top