Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11239  (registered. 2007)
Contig Information
Length 1019 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit transcription factor MYB39 [Zea mays] >gi|89143147|emb|CAJ42203.1| transcription factor MYB39 [Zea mays]
Score 795
Evalue 9.76604e-83
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig11239
gcatccgactccctccctcgcctccgaccatcacacacacagcgcgaGCGTCTTATCCGGGCCTGCGCAAAGAAAAGAGAAGAGTGCAGAGGAGCACACA
GAGACAGAGTAAGCAACAGCAATGGTGAGGGCTCCTTGCTGCGAGAAGATGGGGCTCAAGAGGGGCCCGTGGACGGCGGAGGAGGACATGACCCTGGTCG
CTCACATCGAGCAGCACGGGCACAGCAACTGGCGGGCGCTGCCGAAGCAGGCCGGCCTGCTGCGCTGCGGCAAGAGCTGCCGCCTCCGGTGGATTAACTA
CCTGCGCCCCGACATCAAGCGCGGCAACTTCACCAGCGACGAGGAAGAAGCCATCATCCAACTCCACGCCATGCTCGGCAACAGATGGTCCACCATTGCG
GCCAGGCTGCCTGGCAGGACGGACAACGAGATCAAGAACGTCTGGCACACACACCTCAAGAAGCGATTCGAATCCTCGTCCAAGCCGTCCGGCCAGGCAG
CGCCTAAGCGCAAAGCCAAGAAGCCTGCTGTGGCTGCGACTGCGAGCGCGCTAGAGGGACCGACCTCCGAGCCGGCGGCGTCGTCACCGGGGCAGTCCCT
CTCCATGTCGCCGGGGCAGTCCCTCTCGACGTCGTCCGCCGCTGACTACTCGATGGCCTCGTCGTTGGAGAACACGGGCAGCTCTTCCTCGGAGTCGGAG
GAGTTCCAGATTGATGACAGCTTCTGGTCGGAGACACTGGCGATGTCGGTGCACAGCTCCGGTTCCGGGATGGAAACCAGCGACACCTTCGGCGTAGATA
GTGCATCGCCGTCGTCGAGCAACGATGAGATGGACTTCTGGGTCACACTGTTCATGCAGGCTGGTGACATACAGAGTTTGTCGCAGATTTAGATTTTAat
gagaagattgggccatgttcatatttctcgctagcattcgcggcggaccaggcgaacggcctggccgaacctggaccaggagtccaggacgaacaaaggg
gccatttggccggaagttt
page-top