Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11227  (registered. 2007)
Contig Information
Length 868 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit germin F [Hordeum vulgare] >gi|109729539|gb|ABG46234.1| germin-like protein 3a [Hordeum vulgare subsp. vulgare]
Score 1080
Evalue 6.63806e-116
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig11227
ttaAACAGTGAAAACAAACAT*CACCAGCACATTATGACATGAATCCGACAAAAAACATATCTTGTCACGATTCAAAAAGGAAATGAAAATTCACAGCTC
GCAACCATGCATGCATACGTATTGCATGTCATTTATTCTATATATCATTACATATTAACTTCCC*ATATGCCCAGATAAAAGAGAATATTTAGTAGTTGG
TGTTCCCCCAGAACTGAGATTGAAGCCAGTGAATCAGATCCTTCTCCACCTGAAATGCCGTGGCTAAGACATCATCCGAAATCGGTGGCTTTGATCCAAA
CACTGCATTGGCAATAGAAATAACTCCAGGGTTTTGGCTGCTGAGCGAGGACAACGCGG*CTGCTGGCTTGTCATGCGCTAGGTTCATTTGGAAGTGGAT
CATTGCTTTTGGGAATACGAATACATCACCCTTCTTAACTATCTTTGAGAAGAGCCTGTTTGGGTTGGATGTGACAAATCCAAGGTAGAGTGTCCCCTCG
AGCACCGTGAGGAGCTCAGTGGCACGAGGGTGTATGTGTGGCGTGTTCACACCTAATGGTCCATAGTCGATGCGTGCCAACGAGATGCCGAGGGTGTTGA
GGCCGGGGAAATTTATAACATTGATGTTGGTGACGTTAGACCTGACCTTGCTCGCCTTAGTATCCCTAGGCTGATCGAGCATGGCTGCGTTGAAGAAGTC
TTCCGGGGTTGCGGCCATTGGGTCCTTGCAAGCAAATCCATTTACTCGCACAGGCGCCTTCATGTCGGCAATGCAGAAGTCCTGAAGAGGGCTAGGATCA
TAGGCAGTGGCCTGCCATGAGGCCAGCGCAAGGAGGGCTGCAAGGAGAAACAatgagGAAGaggaagc
page-top