Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9006  (registered. 2012)
Contig Information
Length 882 bp
Clones alternative view 83 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 4
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 5
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_RDr Root of dessiccated seed 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_CA 2
WH_SP 2
WH_XA Root 7
WH_XB Root 13
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115466228|ref|NP_001056713.1|| Os06g0134000 [Oryza sativa (japonica cultivar-group)]
Score 232
Evalue 5.00E-59
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9006
TTTTTTTTTTCCAAGGGAAATGGTTTGTTGAGCCTTTGTTGCTTTAGATATTAAGATTTTGCTCAAGGCAGCAATACCATTTCCACTGCCAAACATAAAT
CAGCACTAAACATTCTAAAGATATGAAAGAAACGCTGTGTGATCTATGGAGACGCTACCAAATCTGAAAACAGGTCCAACAGCGATCCATGTATAAACAT
CCATTCCAGCACACACAACAGGGCAACGAAAATTGACGGAAGATAACTTAGGACGATAGGCACTTAGAATCACGAAGCAAAGAACCTAGTCATACAAAAC
CCAGTTCTCATACTACAGAAAGTTTCAAAAATATCTTGGTACGTTGGAGGTGTCTCTCCACCCTTGTAAAAAGATTTAAAGACACATATCTTGGGGTAGC
ATAACTACTGGTCGCTGATGGTCACTTCGACCTCGACGCCAGGCTCGATGGTGATAGAGGTGATCTGCTTGACAACGTCTGGGGAGCTGACAAGGTCGAT
CACCCTCTTGTGCACCCGCATCTCAAACCGATCCCAGGTGTTGGTCCCTTCTCCGCAGGGGGACTTCCTGGTGGTGATGTTGAGCACCTTGGTGGGCATC
CTGACGGGGCCCTTGACCTTGAGCTGCTTCTCCTTGGCGCCCTTCACCAGATCCGAGCACACCTTCTCGAGGTTCTTGACGGACTTGGAGGAGAGGGTGA
TGCGGATGCGGTGCTGCACCTCCTGCGTGCCCTCGAACCCGAGCTTGCCCGACTTCATGGGCGGCGCGTAGGCCAGCTCCGTCGCCATGGCTGCCGGTGG
GGAGGATGGGAGGGAGGAGGCCGCGGCGCTGCGGGCGAGCTAGGGTTGAGGAAACTTCCTTGAGACTCATCCAAGCCTCGAA
page-top