Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9  (registered. 2012)
Contig Information
Length 690 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_CA 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242064740|ref|XP_002453659.1|| hypothetical protein SORBIDRAFT_04g010020 [Sorghum bicolor]
Score 297
Evalue 8.00E-79
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9
TTATTCAGATCAGTCAGTTTTCGCCGGCGGGGGACTTATACCCGATTTATTTTACCCCACGCGCATTATTACAAAACCCATAGGATTTTCGGCGAATTTT
TATTCACCTAACAAAACTTCGCTCGTCTGAACTTTACTGATGACGACTCTACAGCGGCTGTGGCCTGCTCTGCACTATGTAGATGTCCTCCCCGACCATG
CAGCCCTCCACGTCCTGGGCGCTCCCGAACCTCTGCTCCAGGTACTGCCCCACGGCGGCGAGCCGCTGCCCGAACTTCTGCCTGAAGGTCCGGTCCACGG
AGAGCGGCTTCGTGCTGTAGTCGACGGTGAGCCTCACCACCTCGCCGTCGGCGGGGCCTGAGCCAAGCACCCTCATCTCCTCGCTGAAGTTGGCGAAGGC
CAGGGTGGCGACGTCGGTGTCGAACTTGTCGCACGAGAGACGCCACGGGGTGCCACGGGTGCCTGCAGCAAGGGTCTCGCCCAGCCCCGGAGCTACCTCG
GCCTCAACGACCCTGGTGTCGTGGTCTGAGGGACTGACGGTGTGAAGCACGAAAGAGAGCTCCGGCTCCAGCATCTCCTGCACCAGGACGGCCATCTTGG
CGTCCCCCTGGGGCACGCCAGCCACCCGGCGGCTGAGGATGGCCCTCCGAGTGTACAGTGAGGCCCAGACCCGCGCTACCGCGGACCCGA
page-top