Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11128  (registered. 2007)
Contig Information
Length 619 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSJNBb0061C13.7 [Oryza sativa (japonica cultivar-group)] >gi|116310308|emb|CAH67325.1| OSIGBa0102I15.5 [Oryza sativa (indica cultivar-group)]
Score 333
Evalue 1.39682e-29
Total Hit Count 48
Registered year 2007
Contig Sequence     [ Download ]
>Contig11128
ttttttttttaagttccaggcagtcaactgagaATCAGCAACATCAATATATTACAACCACCATGGACAATGCAAACATACAGTAAAAGACGGCTACAAA
CACAACAACGCATAAGTCGTTCCTTTCTAGTTTCTCAGTTGAGACTAATCAAAACATAGATTACAGGGGGAGTTCCACAAAGCCATCAACATATGTGCTT
TTGCCTTCGATGATTAACTACCTTGTAGAAGGTAGTTCGCACCTTGTAGGATGGTCTCCAGATTACTTTGAAAGAACCCAGTGAGATACCGTAGAATGTA
CCAGAGAAGGCAAAGCATCAATGTATTGAAGAGGTAGCGCTCCCACCAATCGAGCATGTAGAGGCCGATGTTGACATTGTAAAGGTGGATCTTGCGCCCG
ATCCAGTTCATCCTCCCCCAAAGAGACCCGACGCCGCAGATCCCTCGCTCAGATCCGGAAACAAGCGGCGAGATGTCGAACTTTCTGAGGAGGAAGAACG
GCGTGGTGTCTTGCGGGATCGGGCGGGGTCT*CTCAGAGGATCTTCT*CTCGGTCGATGGCGTGGGTTTGTTCGGAAGCTAAACGCTTCAGATCTGAACT
TCACATGTAAGGCTTTTtc
page-top