Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11105  (registered. 2007)
Contig Information
Length 866 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 17.4 kDa class I heat shock protein 3 [Zea mays]
Score 459
Evalue 6.77807e-44
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig11105
ggcgagctcgtgcgctctttcgccactctccagaaagagcaCCGATCAAAGAGCTCCCAGAAATCAATCGATCACCCTTCCGCTTCCAACACCAGCCAAA
TCGTCGATTCCTTCCACCAGCATCTCGAATCCCCACCGATACGACCGACAATGTCGCTGATCCGTCGCAGCAACGTGTTCGACCCCTTCTCCCTCGACTT
CTTCGACCCCTTCGACGGCTTCCCTTTCGGCTCCGGCAGCAACAGCAGCGGCAGCCTCGTCCCGCGCACCTCCTCGGACACGGCGGCCTTCGCGGGCGCG
CGCATCGACTGGAAGGAGACGCCCGAGGCGCACGTGTTCAAGGCGGACGTGCCGGG*ACTGAAGAAGGAGGAGGTGAAGGTGGAGGTGGAGGACGGCAAC
ATCCTCCAGATCAGCGGCGAGCGGAACAAGGAGCAGGAGGAGAAGACCGACACCTGGCATCGCGTGGAGCGCAGCAGCGGCAAGTTCCTGCGCAGGTTCC
GGCTCCCGGAGAACGCCAAGGCGGAGCAGGTGAAGGCGTCCATGGAGAACGGCGTGCTCACCGTCACCGTGCCCAAGGAGGAGGCCAAGAAGCCCGAGGT
CAAGTCCATCCAGATCTCCGGCTAGAGCGATGAAATGGGATGTAGAGCAGTGGTGTGGAGTCTCCCCCCGGTCGTCGTGATGAAATAAAATCAAGAAGAG
TCCGGCCGTCTGTGCGTGCGAATGGTCCAATGTTGCAGTCAGTGTTTTGAGTCTCTCGTGTCAGTGTTTTGAGTCCGGTTTGTTGTTGTTTGTTCATCAG
TCTGTACTGGCTCTGTACTCCATCAGCAActgagTAAATTCATTaccttctctgctaaaaaaaaaa
page-top