Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8996  (registered. 2012)
Contig Information
Length 685 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|293336117|ref|NP_001168951.1|| hypothetical protein LOC100382771 [Zea mays]
Score 228
Evalue 4.00E-58
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8996
TCAAAGCAGTTACTAACTTATTTGACAACTCATGCTTACACCAATGGTTGAAAACCCATTGTGCTGAGATTATTGATTCTTTCTCAAGCTGCAAGCCGTC
TTTTAGCAAGAGCGCTCACTTGGCATATGCCACACTTTTACTGAACTATTCTGTTCTTTCAATTGAATCGAAGGATGAACAAAGTCAGGCACAGATTCTT
TCTGCGGCCCTTGAAATTGCTGAAGACGATGCCCAAGATGCCGATTCGAAATACAGGGCGCTTGTTGCAATCGGCTCTCTTATGTTGAACGGCCTGGTCA
AGTCCATCGCCCTTGACCTCGACGTGAAGAGCGTCACAAGCAGCGCAAAAGCTTCGATGGACTCGAAGATCGCCGAAGTTGGAGCTGATATTGAGCTGCT
AACAAGATGAGAGAAAAGAGTGTCGCAGATACTACATTCGAGAGAAAAGGTGGGAACGGAGGGCTGGGCGGAGCGTTGCAGTTAAGTAGTGGTAGCAGCC
CACATCCGCGCAGGTGGTAGCATAACTTTTGCGTGAGTGCAGGAGAGTTTGCTGCACCTTGTAATCAGTATGGTATCGTGCGAATCCTTCGCCCTGATCA
CAAAGTTTACTATTTATGCGCACGCAGGCGACTGAGCGCACTTTTACATAATAAACACTCTACCACATGAAAAGGAAAAAAAAAA
page-top