Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8991  (registered. 2012)
Contig Information
Length 804 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 6
Wh_r Root 3
Wh_yd Spikelet at late flowering 4
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XA Root 1
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|75282487|sp|Q43208.3|H2A4_WHEAT|H2A4_WHEAT RecName: Full=Histone H2A.4
Score 258
Evalue 5.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8991
GCGACAAAATTGGTAATAGCTTAAAGTTGAGTTCCTTTCAATTTCTTCAACCATGGAAACCGGACAAGATCAAGCAGCCTTACATCTGAGTTTGAACACC
CGAAAATTTGTTTGCCATATTCACAGCCATGGGATGAAAGCAACCAATCCGACCACCAACTAGAAATTCTCCTAATACCATACCATCCGGGACTCTCCTG
AAAACCAAGACACTAAATCCTACGAAACAAGAAACTCCTTCGTCTTTGTGATGCAAATGTAATCCATGGTGCGGGCGGTGGCAGCGAGGGAAAGGACAGG
GCCTCAGTTGTCGTCGTCATCGACGGTGGACGCCTTGGAGGAAGAGGCCTTCTTGGGGAGGAGGTGCTGGTGGATGTTGGGCATCACACCGCCGCTGGCG
ATGGTGGCGCCGCCGAGCAACTTGGTCAGCTCCTCGTCATTGCGCACGGCGAGCTGGATGTGCCGCGGCACGATACGGGTCTTCTTGTTGTCCCTGGCGG
CGTTTCCGGCCAGCTCCAGGACCTCAGCGGCGAGGTACTCAAGGACGGCGGCGAGGTAGACGGGGGCGCCGGCTCCGACGCGCTCGGCGTACTTGCCGGC
CTTGAGGAACCTGGCGATCCTTCCCACGGGGAACTGCAGCCCAGCCTTGGAGCTCCGGGACGTCGCCTTCTTGGCCGCGCCGGTGCCGATTGCCTTCCCA
CGACCGGCCATCTCAGCAACCGAGGAGGGGAACGACGGGAGCCGCTACTGGGAGACGGAACGCGCGAGGGGACAGGAGGCGGTGGAGGCGAGCCTCGTGC
CGAA
page-top