Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8987  (registered. 2012)
Contig Information
Length 635 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218192814|gb|EEC75241.1|| hypothetical protein OsI_11539 [Oryza sativa Indica Group]
Score 161
Evalue 5.00E-38
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8987
AGATTAAACTCAAAACATGTTCACAAGAAACCAGGCCTAGTGACATCAAGTCTTAGCTTCCATAGTAGCAACTGAAACTAACCACAGACATCCAAGAGCT
AGGTAGACATGGGAAGGAAACAAGTTCCAGGTAAAACTAGTAGCAACATCTAGAGCTGCTTGATCTCAGCCTTCCTCTTCTGCCACAGCCTGTCCAGGGA
GCCATCAGCATCACCCTGAGCACGGACAAACCCAGAGAGAGCAAAGGTGGTGAAGCGGCCATCATAGAGGCCATTCTCATCAACGTGACCAATGTTGATC
TGGACAGAGGCGTGGTCCTTGGCCGTGATGATCCTGTTGGTGGCCGAGCACTTCCTGGGGATGTAGAGGTCCACCATGTCACCCACCTCGTTCTGCATGG
TGGCGGCTGGTGGGGGAGTGGCACAGCAACAGCGACTTGATCTCTTGGATTCGAGGAGGCGCTGCGGGAGGACGAAGAGAAGCTGGCCTCGTGCCGAATT
CGGCACGAGGGCAAACCTGTGACAGACGACTTGGTTCTGCTTCGCGACTTTGTTGTGTGTAACTGTGAACTATCTATAGCATATAATTTTGTAAACAAAG
AAATGTACTTAATTAAGTGTCATGTATATAAATTT
page-top