Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8978  (registered. 2012)
Contig Information
Length 1273 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_SH - 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242058703|ref|XP_002458497.1|| hypothetical protein SORBIDRAFT_03g034770 [Sorghum bicolor]
Score 670
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8978
AATCTCCAGCTCCCGATTCGCCATGGCTCAAGAGCAATCCAATCCCAACGAGGTCGTGCTCGGGCAGGAGATCAACGGCGCGAGGGTGGTCACCCTCAAC
CGCCCGCGCCAGCTCAACGGCATCAACGACAGAGTGGTCTATCTCCTAGCCCAGCTCTTGGAGAAATGGGAGAAAGATGCCAATGCCAAGCTGGTCATCT
TCAAGGGAGCAGGACGTGCATTTTCTGCTGGCGGGGACCTAAAGATGTTCTACGAAGGGAGATCATCAGATGATTCCTGCCTCGAGGTTGTGTATAGGAT
GTACTGGCTCTGCTATCACATCCATACATATAAGAAAACCACGGTGGCCCTTGTTAATGGACTTGTCATGGGTGGAGGTGCAGCCATGGTTGCTCCACTG
AAATTTGCAGTTGTCACAGAGAAAACAGTTTTTGCCACCCCCGAGGCAAGTGTTGGACTACACACAGATTGTAGCTTTTCTTATATCCATTCTCGGCTCC
CTGGATATTTAGGGGAGTATCTGGCTTTGACTGGTGCTAGACTGAATGCAAAAGAAATGATCACTGCCGGTCTTGCTACTCATTTTGTCCATTCTGAAAA
ATTGGAAGATCTCGAAAAACAATTACTGAATTTAAACACAGGCGACGAGTCTGCAGTCCGAGCTGTCATTGAGGAATTCTCTACGGATGTTCAACTTGAT
CAAGAGAGTATTTTAAACAAGCTTCCAACTATCGATAAATGTTTCTCAGCCGAGACTGTTGAGGAGATCTTGAAAGCACTTGATTCAGAAGTGAGCGTCG
ATGGAAATCAATGGATAGCTCCAGTCCTGAAGAGTATGAGAAGATCATCTCCTACTGGATTGAAGATCACACTGCGATCGGTTAGAGAAGGTCGGAAGCA
GAGTCTGCAGGAATGTTTGAAGAAGGAATTCGGACTAACAATGAACATCCTCCGATCTATCATTACTGGCGATGTGTACGAGGGTATTAGAGCTCTGAGC
ATCGACAAAGACAATGCACCTAAGTGGAGTCCTGCAACCGTTGAAGAGGTGAAGAATGAAGACATTGACCGTGTTTTCGAACCATTCAGCTCGGGACATG
AGCTCCAAGTCCCATCTGATGATTCCAACAGGTGGAGCGGCAAATACGAGCACACGGTCTATGCTAAATCTTCACAGTAATCACAACATAGCCCAGGCTC
TGGAGCAGCAGCCCTTTGTACTGGTGTTGCTGTATGACATGCATGTTGTGTGTAACATTATGCCAACTGTTGA
page-top