Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10884  (registered. 2007)
Contig Information
Length 586 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to OTTHUMP00000016587, partial [Gallus gallus]
Score 91
Evalue 0.140407
Total Hit Count 32
Registered year 2007
Contig Sequence     [ Download ]
>Contig10884
tcggcacgagggaCAAACCCTAGCCTCACCAAGCCCCACAGCACGTAGTCCTCCCTCCTCCTCCATCCTCGTTAGCAGCCGCCGCCATTCTGCCTCCCTC
CTCTCTGTCCTACGACCATGCTGCCGGGAGGAAGCTATTGTTCGTGGTGCCATACCGCAGCCGGGGTGCTGCACAAGAGGCCAGGGGCCGCCGCCACCGC
GAGCCATGGGACGCCCGTCGATGAGCCTTCGGGCAGGAAGCCCGCATCGAG*CACGCCATCAACAAGCCGCCAGG*ACGACCTACTGGCCGGTCCCGCGT
CGTCGAGCAAGGGCCCTGGTTGCACCGTCGTGGAGGAGGCGCACCATTAAGGAGTAGCAATGCCGTCGAACTCCCTCTTCCCTTCTGTCTGCACCTTCCC
TATGAGCTTTTCTTCCATTCCCTTGCTTTGCCTCTCCTCCTGCTCACTCTCCCTTCCGTGCTCCTCAGCTTTCTTTCGATTTGCTTGTGCCTGCAGGTCC
ATGGACATTGTTAgaatggtTAATTTATTCCAGTGTATTATTTTCAGag*atCATGTTTGTTTAAgactccatggcaaaaaaaaaa
page-top