Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8973  (registered. 2012)
Contig Information
Length 1648 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242038419|ref|XP_002466604.1|| hypothetical protein SORBIDRAFT_01g010860 [Sorghum bicolor]
Score 707
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8973
ATACCTAGATAAATCTAAGACAAATAACTTAGCGTCTCGAATGAGATGACTTAGATTTGTCCAGACAGATATACATCCATACCTAGATAAATCTAATTTG
GGGCGGAGGTAACAGACCGGAAGTTAAAAGACACACTTGAATGAATCCCAATTCAACCTTTCCCGCATGACAACAACAATAGGTAGCTTACAACAACTCA
AATTCAGGCAGACATTTGCCATGTTCTACCATTAGGGCAGACAAGTTGCTAAATTGAACCATAGACACAGAGTCAGTTCAGACAACAGCGACGCAGGAGT
TCCTGGGGAAAAAACAAGGTTCAGTACACGAGTCATCATTGCGATTTAGGATAACATCTCGACGTCGTTTGATAGAGGAATTGCGGTTGTATCGTCTCAG
ACTTCTAAAGCATAATATGTAGCTGACCCGCGCCCATCATTCAATGGATAGCTTCTTTGAGGTGCCCCGGAGCAAATAGTCACGCCAAATTCAGATTTAA
CCGCGACTGCCTCAGGCATGTGATTGATTGGTTGCTAATCAGAGTCTTCATAGACACCCTCGTCGTCATCAAGATCATCAAAGGAGCGAATGTCCAGCTG
ATAGCGGAGGATACCGCCAATGCCACCAAATCCTCTACAGAACTGTGAGCCCTCTTGAGACTTATTGGTAACAAATTCAAGGGTGCAGCCAAACTTTTTG
TATTCATTAGCAAACCATTCCAAAAGTGAGGTCTTCTCCTGGACTTCTAACTCAGCATTGGTAGATGGATCACGGAAGTTGCTCTGGTCGGCTTCACCTT
CTTTGTTCAGATGCTTTATGATAATTTCTCCAGTTGCACTGTGCTTAAGCACAAACCGATTGACATCAAGGTTTTCCCACACCATCAAAGTTTCAACAGC
ACCCATTTCAAGAGCCTTCAGGGTGTCATCAACTCCAAAGACATACTTCCCAGTATCCTGACTAATCTCTTCAAAGTACTTCCCGATCAACTTCTTCTCT
TGTATGAACTTCACATTTGCTAGAATTTCAGCTGATAACTCAATGGCCTGGTTGAAACCGCTCTCGCCACCATAAGAAACATCAACCACATTAAGTATTT
TGCACTGAAGGCGCTGATCAAACATGTCAGATTGGCTCAGTTCTGTTTTAAAATCAGCAGAACCAGCCAATATTAGTCCCGCAACATTAGGCTGGCTGGT
AGCTGGGTTGATGAAGAACTGAGTAGCAAGTTCAGCTGTTTTCCGAACATAATTGTGACGCTTCTCCATCCGAAGGCGAGCAAAACGCAGAGCAGATTGC
CCTCCTCTTCCATGCTTCTTGGGGAGATCCACACTGAATTTGTGAAGCACTTCACGAGTATTGCCACTAAGTGTGCCAAAAAGAGTTCCATTACCATCCA
TAATGATGAAGCCAAACTTGTCATCGGATTCCAAGAGCTCACTCAAGGCTTCAGTGTGGAATTTGTTGTCACAAAGGTACAAGGACGCATTGATGGGCTT
GAATGGCTCAAAATCAATTGTGACCTTCTTTTCCTTGCCATCGTCAGTAACAATTGTTCCAGTGTAAAGAACTAGTCCATTTGGGGGAACCCTGTTATAC
AGCTTCAGCCTCTGCTGAGCTGAGGTGATGGCTCCCAAAACAGATTGA
page-top