Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10841  (registered. 2007)
Contig Information
Length 416 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DANA2 [Zea mays]
Score 241
Evalue 3.35684e-19
Total Hit Count 23
Registered year 2007
Contig Sequence     [ Download ]
>Contig10841
ttttttttttcgtgaaattctcggcacaagacagttgacttaAACCTCATGTTCATGTCATAGCATCGCCAGCGACGACTCAGATGTCACACGACAAGCA
AAAAATGGATAGCGGTAATAGGATCCGAATAATGGTGCACCCAGAGAGGGGCAGTCTGCCTGTTGAGTTGTAGTAGACAGTATGATGACACATGGTGCTG
CTCTATGAGCAGGAACTCCCGCTTGCTCGCTGGCAGGCGGAGGCGGAGGCGATCAGATCTCATAGTTCCACGTGCTCTCCGCTACGAGCTTCGGTGCTTT
GCTTTGATCGGACAGATCGAACGTCGTCGCAACCTTGAAGGAGCCGCCGATGCTGGAGCTCCTGGTCCACTCGAGCCCGAGCTGCTTGGTGGAGgcctgg
taggtgcccctgacgc
page-top