Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10830  (registered. 2007)
Contig Information
Length 762 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytochrome b5 [Zea mays]
Score 595
Evalue 9.12812e-60
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig10830
tgtaaacATAatt*aagTAATCTGGGCATATATATGGATGTTTGGAACTGAGAGTGCCTTGTATGATCAATGAGACAACACACTGCCACCCAACGAATAC
CATCATTATGTTGTTCTAACTCAAACCACCATTATTATGTAGTTCTAACTCAAACCATATTACTTGAAAGCTATTTCTCTGAAGCAACTCGCCAACAACA
GCCTACTCAGATTTGCTGTAGTGCCGGATACCAAATGCAAGCCCCAAGATTAAAATGGGAACAAGAAACTGCAGGATCTTGATGAGGAGGTCGCTATCCT
TGGCCTGGACATGGGACCCTTGCTGAGGAGGTACAAATGTACGCTTTGCTGGGATGGTTGAAGCATCAATCTCCCCGATGTGGTACTTCTCCATCATCTC
CCTTGCGGAATCACTGTGTCCGATATCTTCGAAATCGCTGGTTGCATCTTTCCCTGTTACTGCCAGCAGTACCTCATCTCCACCAGGATGCTCATCCATG
AACGGGGTGACATCATACACCTTGCCGGCGATGACGAGCCAGCAGTCCTTGGTGACGTTGTGCTTGGCGACCTCCTCGAAGCCGAACATCTTCTTCTCGC
CGGCCATGGCTCGCAACACACGCGCCCACGCTGCCCTGGGGCTGGGAGCGGCCGCGAGGCGAGAAGTCGCCGGTGAGGGGGACGGGCCGACGGAGTGGCG
CACGCACCGAGAccgagaaggaagcgaggaggcggaaatggatcacgcgntttggacaggcc
page-top