Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10777  (registered. 2007)
Contig Information
Length 813 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_dL Crown of seedling 1
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0402000 [Oryza sativa (japonica cultivar-group)] >gi|115473673|ref|NP_001060435.1| Os07g0642300 [Oryza sativa (japonica cultivar-group)] >gi|14018082|gb|AAK52145.1|AC084380_18 putative transport protein particle component [Oryza sativa (japonica cultivar-group)] >gi|23237907|dbj|BAC16481.1| transport protein particle component Bet3-like protein [Oryza sativa Japonica Group] >gi|50509929|dbj|BAD30250.1| transport protein particle component Bet3-like protein [Oryza sativa Japonica Group] >gi|108708681|gb|ABF96476.1| Trafficking protein particle complex subunit 3, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548792|dbj|BAF12235.1| Os03g0402000 [Oryza sativa (japonica cultivar-group)] >gi|113611971|dbj|BAF22349.1| Os07g0642300 [Oryza sativa (japonica cultivar-group)] >gi|125544236|gb|EAY90375.1| hypothetical protein OsI_11953 [Oryza sativa Indica Group] >gi|215737020|dbj|BAG95949.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768616|dbj|BAH00845.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218200111|gb|EEC82538.1| hypothetical protein OsI_27064 [Oryza sativa Indica Group]
Score 940
Evalue 1.02421e-99
Total Hit Count 182
Registered year 2007
Contig Sequence     [ Download ]
>Contig10777
gcggcgatgccgcctctcacgacccccaagtccggcgacgccctcttcgccagcgtcgagcgcgtaaacgccgagctcttcacgctcaCGTACGGCGCCA
TCGTGCGGCAGCTGCTCACGGATCTCGAAGAGGTCGAGGAGGTCAACAAGCAGCTCGATCAGATGGGTTACAATATTGGAACTCGGTTGGTCGATGAATT
CTTAGCCAAGTCAAATGTATCAAACTGTGCTGACTTCAAGGAGACTGCTGATACTATAGCAAAGCTTGGGTTCAAAATGTTCCTGGGTGTGACTGCGACT
GTAACCAATTGGGATGCTGAGGGTACAACTTGCAGCTTTGTATTGGAGGACAACCCACTTGTAGATTTTGTTGAACTTCCTGATACTTGCCAAGGCCTTC
AGTATTGCAATGTATTGAGTGGAGTTATCAGGGGAGCACTGGAAATGGTTTCCATGAAGACGGAGGTTACATGGGTCCGCGACATGCTTCGTGGGGACGA
CGCCTACGAGATGCGGGTGAAGCTCACCAAGCAAGTCCCAGAGGAATACCCCTACAAGGATGATGATTAGTTTCATCTCAAAGGGTAGCTCTTCCGCACG
GTGGCGCTTGTTTGCTTGTCTGGATATCCGTTTTGCTTTCCCTGTGGGTGTAATTCTGGTACAGCCGTCATGTTTTACATGAGGCACCTGTGCATTGTAT
TTTGCAGCTGCAATGTGTACCGCAGATGTATTGTAGAGATCTTatatggctttcctactttggaacagtgcgggaaatgaagtgcttttactcnattagc
tgctaaatctttt
page-top