Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8959  (registered. 2012)
Contig Information
Length 723 bp
Clones alternative view 62 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 5
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_r Root 4
Wh_yd Spikelet at late flowering 5
Wh_CSEC Callus 5
Wh_MS Seed DPA5 of DT3DL CS wheat 11
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
WH_SP 15
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115472675|ref|NP_001059936.1|| Os07g0549900 [Oryza sativa (japonica cultivar-group)]
Score 210
Evalue 1.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8959
CACAAGCTCATTGTTTGACGAATTGTAAACCACATCCAGGAGACGNNTCTTGCGGGTCACAGCCTCACTACCCCATGAGAAGTTACCAGTGTCCAGACGG
AGAGCCCTCCACTTCACGTTACCTCCGCGAACACGGACCCTCCCCTCGTGCCGAATTCGGCACGAGGCTTCTTCCCAATCTCGCACACCTCTCGGAGCTA
GGCGGAGCGGCGATGTCGGGGCGCGGCAAGGGCGGCAAGGGGCTGGGCAAGGGCGGCGCCAAGCGCCACCGGAAGGTGCTCCGCGACAACATCCAGGGCA
TCACCAAGCCGGCGATCCGGAGGCTGGCCAGGAGGGGCGGCGTGAAGCGCATCTCCGGCCTCATCTACGAGGAGACACGCGGCGTGCTCAAGATCTTCCT
CGAGAACGTCATCCGCGACGCCGTCACCTACACAGAGCACGCCCGCCGCAAGACCGTCACCGCCATGGACGTCGTCTACGCGCTCAAGCGCCAGGGCCGC
ACCCTCTACGGCTTCGGAGGCTAGATCCGTGGGTTCCGCGGGTGGCGGTAGCGGTAGTTGGGACTGTGTCTGTCGTGTGTCCTCTGTGATGTGTGCTGTG
GGAGATGGGATTTGCTACCGCTTTGGCGTGCGTCGTTGTGTTCCGTGTCTTGTGTTCATAGGCTGTAATACCTTGTTGCGGTCAATGAAACTAGTTCTGT
TCTGAAAAAAAAAAAAAAAAAAA
page-top