Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10667  (registered. 2007)
Contig Information
Length 842 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pyruvate kinase, cytosolic isozyme [Zea mays]
Score 645
Evalue 8.90011e-110
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig10667
gggtatgcgtagcctcgcAAAAAAAAAGGAAAATCCCCAGGCAAAATGGTGTTGCATTGTCGCTGCCACAAGCTTACACGGTCAAGAGCTTGATGACGGA
TGCATTCCCGATGCGGTGAAGGGCCACAATGGACTCACCAGCGTTGCAAAGCCCCATCTCCTTGGCGTTCTTCATGGCAAACCTCAGTGCCTCTTCCGTG
GCTTCACTGTCAAACGCCTTGGCAGTGCCAGCACTcagcaTAGGGATCACGCCCCTCACGATCAGGCTTTGCCTGGCAGGCCCCTCgtcgctgcagatcc
agtcaaactcgaccgtcttgagctcaggaaccacgACAGACAGTATCGGCATGGATGGCctgtaCTTGGCTACAAGCCTTGCaggttgTTCCtcccctgG
TCAGTACCAAGATAAGCGTCGCcttagcTGAGTTCGCTGTGCGGACAGCTGATGAGGCAAGGCTCTCCAATGGGCTCATGGGAATTGGGGCTGATGACAT
GATTgacttaAAAACAGCAGAATAGTCCACACATGACTCGGCCTGCAAGCAGATCTTGGCCATAGTTTGCACTGCCAGTTCTGGATAAGCTCCAGCAGCT
GTCTCACCACTGAGCATGACACAGTCAGTGCCATCAAGAACTGCATTGGCAACATCGGTTGCTTCAGCTCGAGTAGGGCGAGGAGACTTGATCATAGACT
CCAACatctgAGTTGCGGTCACAACTGGCTTGCCCTGAATGTTGCACTTGAAAATCATCaccttctgtgcataaaagatcttctctacaggaatttccat
ccccaaatcacctcttgccaccataaaagccctcgtgccgaa
page-top