Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10650  (registered. 2007)
Contig Information
Length 590 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_26905 [Oryza sativa Indica Group]
Score 635
Evalue 1.20212e-64
Total Hit Count 133
Registered year 2007
Contig Sequence     [ Download ]
>Contig10650
gcaggtatccaaggtcatatcggaagggggatacgacaagatattccagcagacgtttgagtgcttgcctgacgagaagctcaagaaggcgtacgcgtgc
tacctctcgacctctcatggtCCGATAATGGGCGTCTTATACGTCTCCACCGCCAAGCTTGCATTCTGTAGTGACAGCCCCGTGGCATATGTCACTGAGG
ATAATCAGACCGCGTCAGCCATTTACAAGATAGTTGTACCTGTACCTCACCTGAGATCAGTCACTCCTACCGCAAGTCAACAGAACCCTGCGGAGAGGTA
CATCCAGGTCGTTTCTGTCGATAACCATGACTTCTGGTTCATGGGCTTCGTGAACTATGACAGCGCTGTGAAGTGTCTCCAGGATGCTGCTCGTGGTGGC
GCCTAGACATCACTTCCCCGTCGCATGTATCCGTTGTGATGGCCCATGTTGATGTCTATAGACCATTCTTGTGTATTTTGGTTCAAATTTCTGGCTTAAA
TAAGCAGTGCATTCATGTATCAGTATTCAGTAGTGTGGCCCAACTGTGTTGTAAATATCAGAGGAATCTTAag*ctTTGTTTGTGTTgtt
page-top