Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10641  (registered. 2007)
Contig Information
Length 487 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative senescence-associated protein [Pyrus communis]
Score 359
Evalue 7.11968e-33
Total Hit Count 116
Registered year 2007
Contig Sequence     [ Download ]
>Contig10641
aattcGGCacgagggaAATctcgtGTGGAacAAAAGGGTAAAAGCTCGTTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTATCGA
TCCTTTAGATCTTCGGAGTTTGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCAGCCAAGCGTTCATAGCGACGTTGCTTTTT
GATCCTTCGATGTCGGCGGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGTGTCCTAAGATGAGCTCAACG
AGAACAGAAATCTCGTGTGGAACAAAAGGGTAAAAGCTTGTTTTCTTCTTCTTTATATCGGGCTTACCTATGCTGCCGCCCCTGCCCGAACTATTTCCCT
TTTGCTTGCTGAACCTTTGTATTCGAtaatcgtgttcttgtggaactcgtcgatttatctatataaagtgaggtcgaaaaaaaaaaa
page-top