Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10598  (registered. 2007)
Contig Information
Length 549 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit postsynaptic protein CRIPT [Zea mays] >gi|195628180|gb|ACG35920.1| postsynaptic protein CRIPT [Zea mays] >gi|195638164|gb|ACG38550.1| postsynaptic protein CRIPT [Zea mays]
Score 508
Evalue 5.32252e-50
Total Hit Count 105
Registered year 2007
Contig Sequence     [ Download ]
>Contig10598
ttttttttttgccagggcagCAAAAATCCACATTGCTCAAGGGTGCAAATTACAGAGACAACCACGCCCGTTTACACAACTGTTAAAAATTGCTCTTTTC
ATAACACGCACACAACACCTTTTTCCACAGCAATATCGCTAGTACATGATGTCATGATCTTACATGTTAAACATACCAAGTCCACCACTTGAGTATCCTG
CTCACACATTGCTTTGCTTGTACAGCTTCGTGTCCAGCACTTGCTTGCCACACATCGCACACACCCCTTTTGAATAGGCACAGGTGTGGCAGTATTTACC
GTCCTGGTGCACCTGTTGCTTGCAGATTATGCATTTGGTATTTCCGTAAGGAGTCCACCTGCTCTTCTTGGAGAGGAGCTTGTTCTCGTTGATCTTGCGG
CCGCCGCCCTCGTAGGTGTTGCTGGCGCCCTCCTTCCACTTGTCCGGGACGATCACCTTCCCCAGCTTCTTCTCGCACTTGGTGCACACCATCGCCGCCG
CCGCCGCCGCCGCCGGTG*ATCGGGTTTTTTTTTT*ctTGAGATGCTgc
page-top