Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8945  (registered. 2012)
Contig Information
Length 646 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XA Root 2
WH_XB Root 4
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218192725|gb|EEC75152.1|| hypothetical protein OsI_11358 [Oryza sativa Indica Group]
Score 253
Evalue 1.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8945
TTTTTTTTTTTGAAAGAACACAACACGCATCAATGAGACGATTCAGCTTCAAGTTTCTTGTCCATACATTCACAGCAGGATGGTTTCGGCTATTCCATAG
ATAGAGCAAATGTTCCTCGCACAAACTGTTATGTCAATTACAGGAATTATTCGATTGAGATGCAAAGGACATAGCTGCCATGAAGATTGACCGACAACCA
AGAGCTTCTTTAGCCTGGGGGCCAGTTCATCTGCCTCCCTCCAAGGAGATGGACATGGATGTGGTAAACAGATTGACATCCACTAGGGCCATCATTGATG
ACAATACGGTAGCCATCTTCAAGTCCTTCCTGCTTAGCGATAACTTTTGCAGCGTAGAGGAGGCAGCCAAGTATCTCTACATGCCTCTCTTCTGCCTTTG
AAAGGCCGGTTAATCCATCCTTGACTTTGGGAATGATTACAATGTGGGTCGGAGCTTGAGGATTTATGTCTCTGAAAGCGAGGACCTTCTCATCCTCATA
CACCACCGTAGAAGGTATCTCCTTTTTGATGATCTTGTCAAATATGGTGGGGTTGTCGTTGGGCACGGGGGCGAGCGCCGCGTCTTTCTCCGACGCCATC
GATCGACCTCCTCGAGCACCTGGTTGGTGCCTCGTCGCCCTCGTGC
page-top