Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10558  (registered. 2007)
Contig Information
Length 827 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0671800 [Oryza sativa (japonica cultivar-group)] >gi|108710331|gb|ABF98126.1| Helix-loop-helix DNA-binding domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549342|dbj|BAF12785.1| Os03g0671800 [Oryza sativa (japonica cultivar-group)] >gi|215741494|dbj|BAG97989.1| unnamed protein product [Oryza sativa Japonica Group]
Score 523
Evalue 2.33043e-51
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig10558
acgccctgatgctGTAGTgatacGTACAGATGCaCCAAAAAACCGGTAACATGCTAAatcgaACATGTGCCCGAGATTCTCaCTGGTCATTATTAGTGTA
ACTCACAATGCACgc******aCACTCACACACTAATTGAACATGCTAATTCGaCATGAGCTGCCTGCTTGCCgcatcTTAa*gtctTTGCGTCTTCATG
TTTATTGGTCCTCTCCTAGCTAGAACTATCATTTGCCGcTATGATGtcgGCGCAAAGCAGAGTCGAGCTTCCATACAATGTCGtcCGCTGTGACGGTGAA
GCCCTCGTCTACctTGGCCATGAGGTTTATGATCAGAGTGGAAGCCGGGAAAGACACGACATTGGTATGTGTGATGCTAAGGTGGAGCCCCTCGACCTCG
GCGAGCAACGTGACAAGGACCCCTTTGCCGTCCTGGCAGTGGATCCTCATCATCACATTGCTCTCCGAGATCCTCGCCTCGATCTCCGGCAACGGGATCC
TTGTCGTCGGCGGACCTCCTCCAGCTGCTGCTGACGGCGGCGGTGACGGGCAGCCATCATCgccgTTGGAGATGCACGGCCTCTTCACTAGCACCACCGA
GTCGATGCTCCTCACCTCACGGTCCTGGAGTGCCTTGAGCTTCTCCTGCTGCTCCTTgacgcacctcagtgcgtcggacagtatggtcgccttgtccatc
ctcttgaggccggggatgacggtggagagctctatgaagcgtcggttgatcttctcccggcgcttccgctccgccatgacgtgttcgtgcacggtcggct
ccatccctgcctcgtgccgaattcctc
page-top