Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8940  (registered. 2012)
Contig Information
Length 720 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|75994087|gb|ABA34079.1|| pathogenesis-related protein 1 [Zea diploperennis]
Score 237
Evalue 8.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8940
AATCACACACATATCATCTTGTGCAAAGATCGATCAACTAGCGATGGAGTGCTACTACTCTTCGAAGCTAGCCTGGTCCCAGCTGGTCCTCGCCTTGGCC
ATGGCAGCCGCCATCACCTCGCCGTGCGCTGCCCAGAACGCCCCGGCGGACTTCGTGAGCCTCCACAACTCTTTGCGTGCGCTTGTCGAAGTCGGGCCGG
TGACATGGGACACCACGGTGGCGAATTACGCGCTGAACTATGCGAACCAGCGCAAAGCCGACTGCAACCTGGTGCACTCCGGCGGGACGTACGGGGAGAA
CATCTTCTGGGGCTCCGCCGGCGGCACCTGGACGGCGTCGAGCGCCGTCACCATGTGGACCGACGAGAAGCAGTTCTACGACTACGCCACCAACACCTGC
GCGACCAACAAGGTGTGCGGCCACTACACGCAAGTGGTGTGGAGGTCCTCCACGTCCATCGGCTGCGCCCGCGTCGTCTGCGACAGCAACCGCGGCGTCT
TCATCATCTGCAACTACAGCCCGCGGGGCAACATCGCCGGACAGAAACCCTACTAGCTAGCTACATTTATATATATGCCTTAATTTCTTCACGCATGTTA
TGTTGTTTGACAAAAACAATGGGGGTAACGCATGCTCATGAATCTATATATGATTCATGCATGTACGTACTTATGCCCCATGGAATAAGCTGTGATCTAT
TATTGTTCTTATATAATCTG
page-top