Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10471  (registered. 2007)
Contig Information
Length 796 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0267900 [Oryza sativa (japonica cultivar-group)] >gi|113532219|dbj|BAF04602.1| Os01g0267900 [Oryza sativa (japonica cultivar-group)]
Score 760
Evalue 7.33376e-79
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig10471
aacaagagaccccccgcccccctctctcctccacctccaccttcagcgctcgccgcgagaagccgagaggagcctgagaAGGTAGCATCATGGCGGACCA
ACTCACCGACGACCAGaTCGCCGAGTTCAAGGAAGCCTTCAGCCTATTCGACAAGGACGGCGACGGTTGCATCACAACCAAGGAGCTGGGAACAGTTATG
CGTTCGCTGGGGCAGAACCCAACCGAGGCAGAGCTCCAGGACATGATCAACGAGGTCGATGCCGATGGCAACGGCACCATCGACTTCCCAGAGTTCCTCA
ACCTGATGGCCCGCAAGATGAAGGACACCGACTCGGAGGAAGAGCTCAAGGAGGCCTTCCGGGTGTTCGACAAGGACCAGAACGGCTTCATCTCGGCTGC
AGAGCTCCGCCACGTCATGACCAACCTCGGGGAGAAGCTAACGGACGATGAGGTCGACGAGATGATCCGCGAGGCCGACGTCGACGGGGACGGCCAGATC
AACTACGAGGAGTTCGTCAAGGTGATGATGGCCAAGTGATCCAGCCGATGTTCATGTCCGGTGGTATTATTATTTTTACCGGGGAGGAGGAAATTGTGCA
TTGCATATTAGTAGTAAGGAATGCGGCTCTCGTTTCCTTGTCTTTGCCCCGAACCAGAAGAAGCGTACTAGTAGACGTAGTTGCTGAAGAGCACTCATGG
AATCCTCCTCCCCTGCTGCTACCCTGTCTct*ct*cccgTGTGTCATTGAAACATCTTTctttnctgtgtgaatctgcaagacttggccccttcgt
page-top