Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10460  (registered. 2007)
Contig Information
Length 565 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit early nodulin protein [Brachypodium sylvaticum]
Score 329
Evalue 3.23834e-29
Total Hit Count 66
Registered year 2007
Contig Sequence     [ Download ]
>Contig10460
gcacgaggcTCATCTTACCTGACGCAGTTCACTGCTAgccaatTCACTTCTCGTACCACCAACCTCCCTCGCCAAGATGTCGACGGTGACCCGCGCCTAC
CTCGACCAGAGGCTCGCCGCCGCCAAGCGCTGCTCCAAAGAAGCTACCATGGCGGGAGCCAAGGCCGCGGCCGTCGCCACCGTCGCTGCCGCAGTCCCCA
CACTGGCGAGCGTGAGGATGCTGCCGTGGGCCAAGGCGCACCTGAACCCCACCGGGCAGGCCCTCATCATCTCCACTGTCGCTGGGATGGCCTACTTCAT
CGTCGCCGACAAGACCATCCTCTCCATGGCCATGGCCAGGAGGCACTCCTTCGAGGACGCGCCGGAGCACCTCAAGAACACCTCCTTCCACTAGTTAGAT
CCATTATTAGTAATGCCCAATGAACCGTGTATGCCAAAGTGCATAGCGTACAGTGATCAGCAAAGGGAGGTCATAATATAATTTTCATCATGCAAGTAGC
CATGTACAGCATCTTTTGAG*CTAGCAATACTGAAAG*ATGTACCAGCatttgttaaaaaaaaaa
page-top