Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig890  (registered. 2012)
Contig Information
Length 1816 bp
Clones alternative view 112 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 5
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 10
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 10
Wh_VHS Shoot with heat shock treatment 5
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_SP 7
WH_XA Root 8
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 11
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|6136111|sp|Q43772.1|UGPA_HORVU|UGPA_HORVU RecName: Full=UTP--glucose-1-phosphate uridylyltransferase; AltName:
Score 922
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig890
GCTGCAGGAATTCGGCACGAGGTGACATCTGCTCCCGTCCTCTCCTCTCCTCTTCCCCCGAGGCAGCAGCGTCCCTCCTCTCCGCCCGGATCGCGATGGC
CGCCGCCGCCGTCGCCGCCGACTCCAAGATCGACAACCTCCGCGACGCCGTCGCCAAGCTCGGCGAGATCAGCGAGAACGAGAAGGCCGGGTTCATCAGC
CTCGTCTCGCGTTACCTCAGCGGCGAGGCGGAGCAGATCGAGTGGAGCAAGATCCAGACCCCCACCGATGAGGTGGTGGTGCCCTACGACACCCTCGCGC
CCCCTCCCGAAGATCTCGACGCCATGAAGGCCCTGCTCGACAAGCTCGTGGTGCTCAAGCTCAACGGAGGCCTCGGCACCACCATGGGCTGCACCGGCCC
CAAGTCTGTCATTGAAGTTCGCAATGGGTTTACATTTCTTGACCTTATTGTGATTCAGATTGAGTCCCTGAACAAGAAGTATGGATGCAGTGTTCCTTTG
CTTCTAATGAACTCTTTCAACACTCATGATGACACACAGAAGATTGTTGAGAAGTACTCCAACTCCAACATTGAAATTCACACTTTCAACCAGAGCCAAT
ACCCTCGCATTGTTACTGAAGACTTCTTGCCACTTCCAAGCAAAGGGCAGACAGGGAAGGATGGCTGGTACCCCCCAGGCCACGGTGATGTGTTCCCCTC
TTTGAACAACAGTGGAAAACTCGATACCTTGCTGTCACAGGGAAAGGAGTATGTCTTCGTGGCGAACTCAGACAACTTGGGTGCTATTGTTGACATCAAG
ATATTAAACCACCTGATCACTAACCAGAATGAGTACTGCATGGAAGTTACTCCAAAAACATTGGCTGATGTTAAAGGTGGTACCCTCATCTCATACGAAG
GAAGGGTCCAGCTCTTGGAGATTGCCCAAGTCCCTGATGAGCATGTGAATGAATTCAAGTCGATTGAGAAGTTCAAGATATTTAACACCAACAACCTGTG
GGTGAACTTGAAGGCGATCAAGAGGCTTGTAGATGCTGAAGCACTTAAGATGGAAATCATTCCCAACCCTAAGGAAGTTGATGGCGTGAAAGTCCTGCAG
CTAGAAACCGCAGCTGGAGCAGCGATCAGGTTCTTTGAGAAAGCAATCGGCATCAACGTTCCCCGCTCAAGGTTTCTGCCCGTGAAGGCTACATCTGATT
TGTTGCTTGTGCAGTCTGATCTCTATACCTTGGTCGATGGCTACGTCATCCGCAACCCAGCCAGAGTGAAGCCATCAAACCCTTCAATTGAGCTTGGTCC
TGAGTTCAAAAAGGTTGCCAACTTCCTTGCCCGTTTCAAGTCGATCCCCAGCATCGTTGAGCTCGACAGCTTGAAGGTCTCTGGTGATGTCTCGTTTGGC
TCTGGAGTCGTGCTCAAGGGCAACGTGACCATCGCAGCCAAGGCTGGAGTCAAGTTGGAGATCCCAGACGGAGCTGTGCTCGAGAACAAGGACATCAACG
GCCCGGAGGATCTTTGAGTGACGCCCACCGCCATCGCCAGTCGCATTCCCAGAAACCTTCCGGTCCTCCTTCGCTGAGTTAACCGTCCTGTAATTTTCGT
GTGCATTCTGCTGGGGTGTTGTCCTGGGATAGCCCCTTTACATAATAATTGTAATCCCCTATGTGCTGTTCATCTACACTTGTTCTTCCTGGCCGTGCCA
GGGACGTAAAATTTCTTTTGGTTATATGATGATGCCCATAGTTCTCACATGCCTAAATTTGTTTCTTTCACCCTGCTGGGCTATAAGAGTTGCTTTTTGC
TGGAGTAAAAAAAAAA
page-top