Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8892  (registered. 2012)
Contig Information
Length 987 bp
Clones alternative view 71 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 4
Wh_h Spike at heading date 3
Wh_r Root 2
Wh_CSEC Callus 4
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_CA 3
WH_SP 11
WH_XA Root 5
WH_XB Root 6
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115475908|ref|NP_001061550.1|| Os08g0326400 [Oryza sativa (japonica cultivar-group)]
Score 503
Evalue 2.00E-140
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8892
TTTTTTTTTTGATCATGGATACTAGCTGGCATTAAACAAAAATACTTCCTTCTTACACTGTTCTTTCCAACATGTCTCGGACAAACAAAAATGACTTTCA
AAACTGAAGCCAAACAGCCACAGTATGCTTGCACACTACTCAAGGATGAGCAATAGATATGGTTTAACAATGCTAAACTTAGTTCATCCGCTGCGCAGCC
TCCTTTGCGATAAGCCTTTCCCTGGCCTTGGTCTTCGCTTGCGACTTGGAGCCCATGACACCACCACCCCACTTCTTCCTAACCTCATCAAATTTGTCGT
TGAAGTTCGCCTTAATAGCCTCAAGGATCTTGCTGAACTCAAGCTTATCCTCATTCTTCACTGTGGTCAGGCACAGAACAGAGGCAGTCTTCTTGTGAAC
AATCGATCCAAGGCGAGATTTTCCCTTGACAATGCAGTAAGGGACCTCCATTTTCCTGCAAAGAGCAGGGAGCCACACAACCAGCTCAATCGGATCAACA
TCATGAGCTATGACAACCAGCTGGGCTTTACTCTGCTCGATTAGGTAGGTAACATGGTTAAGGCCATACTTAACAACTATTGGCTTCTTGGCCTCAACAG
TCTTCCCTTCAGCTTCAGCCTGGGCCCTCTTTAGAAGCCTCTCCTTCTTGGCAGCTTTGTCTTCAGGCCGGTACTTAAGAAGCATCTTGAACAAGTTTGT
TGCAAGGTTCTTGTCGAGGGTGCGGGTGAACTGGTGGAGTGCCGGGGGCACCTTGAGGCGCTGCTTGAGGATGCGGCGCTGGCGCTGGATTCGCACAACC
TTGGGCCACTTAACGAAGCGGTGTAGGTCCTTCTTGGGCGGGAGGGCGCCGCCGATACCGAATTGCTTCGGCCTCTTCTCGAACAGCGGGTTGGTCACCT
TATCCGTTTTCTTCTTCGCCGGGACCGGCGCCTTGCCGCCTCGCTTAGGGGCCATTTCGCCGGCGGCTGGTTGAGGTCAGCGGAGCG
page-top