Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10030  (registered. 2007)
Contig Information
Length 698 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 663
Evalue 9.87613e-68
Total Hit Count 82
Registered year 2007
Contig Sequence     [ Download ]
>Contig10030
aaaaaaaatACTTAAAAG*ATGTACAGCAAGACATGAGCAAAGTAATGATATGCGGACCGCTAAGGAGAAGCTAATATCGAACAGCAGGAAAGCAGAACC
GGACACAAACAACCTGCCTCCGTTCTCAACAATCAGTCACCTCAAACCATTTTTTACATCTAACGTATAACAACGCATGCTATCTATCGAAGCTTTGACT
CGTTGGTTTTGCTGCTCCGGAAGTTTGAGAGGGAGAAGAATGACCTTGATGCTGCTTTAGTTGACGGTGCAGCTCCAGGCCTGTCCCGTAGCCTATCCGA
GCCTGTGGCATTGAAGCTGCTGGTCGTTGATTGAGCTGATAAGATGCTATTAGTCTTGGAACCATCAAAAGTTCTCCTGCTGGAATTTACACCATCACTA
GCACCGGATTCTTCTTGTTCATCCTCTCCATCAGAAACCACCGATGGGCTTGCCAAACCATTAGTGTTGTTGTCTCCTTTGTTTTTCCGAGCAAATTTAA
GAAGTCTCTTGAATCCTTTTGGAGAATCTTTATGAAAAACTATTGCGGGTGGGTTTTCAGCATTTCCCCACTCTATTATTTCTGGTTCGTTGCTATCTGC
TTGCAACATTTGTGACAACGAATGACGGATTCTTGGGCTTGAAGACGGTAACGGTTCAATTGCTGGCGAGGTGACatcctcgcctgtcacgctttcac
page-top