Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9924  (registered. 2007)
Contig Information
Length 1211 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0620100 [Oryza sativa (japonica cultivar-group)] >gi|47847792|dbj|BAD21568.1| kinetochore protein-like [Oryza sativa Japonica Group] >gi|113536983|dbj|BAF09366.1| Os02g0620100 [Oryza sativa (japonica cultivar-group)] >gi|125582911|gb|EAZ23842.1| hypothetical protein OsJ_007325 [Oryza sativa (japonica cultivar-group)] >gi|215708800|dbj|BAG94069.1| unnamed protein product [Oryza sativa Japonica Group]
Score 588
Evalue 1.26527e-58
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig9924
tggacaatttttcatacaaaaaaggttgtattcgacagaaacactccatgGAGAgtttacTGCAGACCTTTTATTTGTTTATCTCAATTTCGTGCAGCGG
CAACAATGGTGAACGGATGGGATTAAGCACTAGAGGCCTTATAGAATGCTGGAGAATGGAGAATGCTACTGTGCTAGTGGTCTTTTGAGTTGGAGCTGAC
ATGTACATACAGCTGTTCTGATAGAACTGCAGTTGAGGTAGCTAGCGAGAGGGTAGCTTGACAACATTACAGCGGACTTGGTAGTACATGGGGCGGTCGA
CATCCTCATACTGCGAGCACCCACAACACAAG*TTACTCCTCCCGCGAGCCATTCACAGCCGCGTTCACCTCTTGAATGTCCTCGGTGCTAGGAGCGGAA
CCTGGTGCTAAACGCTTCTGGTCTCTAAGACAATTGACGTTCCAAACATTTTGGCCCACCATGGCCTCAAGCTCAACCTTTTTCCTTTTCATAACCTTCA
TTTTCTGGTGCAATTTTGGTATTGTGTTCGCAATAGCTTGTATATTCTCTTGAACAGATTTGTCTTCAAACAACTTCAGTACTTCAGCGATAGAGgaatt
aaggttactctTGTATGTAGTTTGCCTTTCCAAGGAAGAAATTTCTCTTTGAAGTTCTTCAGATTCCTTGTTAGCATCTGCCAGTTTTTTTCTCAAAGAA
TTAAGTTCTGCATCCAGTTCCAAATCAGAATTCCCTTCTTTATGCAACACCATTGCAGAAGAATTATCATCTTCAGGTGGCACAAATCCTTCAGGTACAG
TTAAACACTTCCGAAGGCAATACATCTCCCAATTGTTCATTCTCTTGTCCAATACATGCTTTACCAAGTGGTGAATTTCATTTACTCCCCGTTTCAGCTC
CTCGGCCTTATtggtcgccgtggcggcgccgaccgccgtgggggcgccttcctggaggcagtactcgaaggcctggaagcagatgtcgtcgacgaagttg
aggacctcgttgatgaaggtctgagggttcagtccgagcgccgcctccgccgccgaggtctcgccgtccccttccatgcctcccgttgcggcccctctag
actagcgggcggcggccttgaatcgtggcggcgtgtgtgcagctgtgagtggagaggcggctgattggactggacacgggagtatcgagtagctcgggnn
nccggcggccg
page-top