Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8878  (registered. 2012)
Contig Information
Length 1146 bp
Clones alternative view 49 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 8
Wh_f Spike at flowering date 1
Wh_EM Dormant seed with water absorption 13
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|162463849|ref|NP_001105634.1|| ribosomal protein s6 RPS6-2 [Zea mays]
Score 449
Evalue 3.00E-124
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8878
TTTTTTTTTTAAATGGCAAGTACTTGAGTAGAAACCAACATACAACGATAGAGTACTCATCATGTTCATGGTAACCTGCATCAGGTACAAACCCAGGAAA
ACTACTCCAGTAACAAAACTTCCGATAATAAAGTACGCATGTTCACGCAAAACTGCATCAATTACCAACCCAAGAAAACTGAAAGTAGCGGGTAGATTTT
TCCAACAAAGTACGAAGGACTGTAACCATCTTAAGCAGAGGCAGCAGGAGCCTTGGTGGCAGCAGACAGCTTCGACCTCCTCTTGGCCATGCTCTCGCTC
CGGCGGTCCCTCTGCTCCTTCAGCCTCTGTGCAAGCAGCTTCTGGTACTCGGCAGCCTCTGACTTCTTCTTGGCGATCCTCTTCTTCTTGTCTGCGATTC
TGGCGCGCTTCCTCTGAAGGGTCAAGGGAGTCACAAGACGCTGGATCTTGGGAGCCTTGCTCACCTTCTTGCCCTTCTTGTTAAGGAAGGTCCTGCGGTA
TGTGTTGACATAGCTGCGGACATCATCATCCTTGCCAAGGTTGAAGAGCTTCTTGATCTTGGAAGCCCTCTTGGGTCCCCTCATCCTGGGCTTCTCAGTG
TCGGTCAGACCTGGCAGATCATTCTCACCCTTCTTGACAATCACCAAGTTGATAACAGACAGGTCTTGGCTGACAATGCAACCACGGACAGACTTCCTCC
TGCGCTCACCGTTGCGCCTGCCAAACCCACGGAAGCAAGGTGTGCCCCTGTGAAGCAGAAGGCGGACACGCCCAGAAGTTAGCACTCCTTGCTTCATTGG
GAAGCCCTGCTTATCACAGCCACCCATGATCTTGAAGATGTAACCCTTGAATTCCTCACCCAGAAGATCACCAACTACCTCCTGGGAGATTCTCTTGTCA
TAAAGGTTCCGCAGCTTCTGGTCGTCATCGATCTCGACCTTCTTCTGGCACCCCGTGGTGGGGTTCGCGGGATGATGACGAGGAGTGGGAGTTCATGCGC
GGGCTCACCGTGTGAGGGCGAGCTCTTTCTATATCTATCGCCGGTCCAACCGGCCGGTGATGTTGTATCGTGTCCATGGTCGTAGTGAGGTCGTCGGGCG
TCTCGTCGCCGTTTAGTTTCGCCGGAGTTCGTTTTGGCGCCATCTT
page-top