Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9886  (registered. 2007)
Contig Information
Length 790 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_022830 [Oryza sativa (japonica cultivar-group)]
Score 257
Evalue 1.53066e-20
Total Hit Count 174
Registered year 2007
Contig Sequence     [ Download ]
>Contig9886
gcctcccccggatttggggtgggacagagttgagcgccgtcgcgcaccaccggaggtggagatgGAAAAGAATTACAGATGGTGCCCAACATTTCC*TAA
TCTTACAGACCTGACGCTTCATAGTTGGTGTGTGTGTGGGAATTTCTATGCGCTGACAGTCTTCCTTCAGAACTCACCTAATCTTAAGAAGCTAACTCTT
GATCTATACCAGCCTTGGTATGAAAATGGGGTTATATGTGCAATCACTGGTGAGCTGGAGGATAGATCATTTACATGTGAGCAGCTTGAGATTGTTGAAA
TCATATGCTCGGAGGGAAATGAGCTGCTACCTTGGGTGAATCAGTTCTTGCTTGATAGTGGCATAAGGCCTGATCAGATGCGTGTCAGTTACGAGGACTA
AGGCCAATGGATGCATTTGATGATTCAGGTCCTACTACAGGTGAAATTACATGGGATCACACATTGGCATGTCATCTCAGGCAAACATTATTACATTATT
TCCTCTTGGGTCTATATTCGCTCGCTCTGTTTTAGTTGGAATGAACATAGCATACGTGTTTGCTGCCCTTGCCTTTTTCACACAGTAGTGGTGATTTTGA
AGCATGTTCTGCTGACGGTGAACCAAAAGAAACATAGACTTAGATGTGTCATTTTCCTACGTGGTGCCATTCTGGTAGAACGTTTTACTACATGAGACGT
GCAGAATTGCCTGTTTTGGTTGGAGTTTATGGCTCTAAATCTCCGAGGATACTTTTCTTGTAACTACTCTGTTAGCTCATTCGGATTTtg
page-top