Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9879  (registered. 2007)
Contig Information
Length 387 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit metal ion binding protein [Zea mays]
Score 90
Evalue 0.109757
Total Hit Count 23
Registered year 2007
Contig Sequence     [ Download ]
>Contig9879
ttttttttttaaccaatGGAGCTCGTGGCAGG*AACGAACAATGGT*CGATCAGGGGCAGAGACAGCAGAGAAAAGGCAGGGGGAACCAAAATTTGATCG
GAGGCACGCATCGGTTCATGGATGGACGGATGCCTCCGATCCAAGTAACTAGAGCTAAGCTAAGCTAGTGGAGAGCCTCGTCGCTGTCTGCTACTATGTC
AGCATTGATCTTCTCTCCCGGCCGGCTGGCCGGCGCAGGTCGTCGGCGCTGATGAGTGAATTTTCGGGCGGCGGGTCGCGTCACATGACGGAGCAGGAGT
TGGGGTTCTCGTCGCTGAACATCTGCGAGGGCGGCGCCGTGTCGAAGTGGTAGGGCGGCGGGTACGgctggtaCGCCTGGGGGTTgc
page-top