Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8873  (registered. 2012)
Contig Information
Length 881 bp
Clones alternative view 94 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 10
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 3
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 3
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_CA 1
WH_SP 1
WH_XA Root 2
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14585879|gb|AAK67641.1|| ribosomal protein L15 [Homo sapiens]
Score 422
Evalue 3.00E-116
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8873
TTTTTTTTTTAAAAAAACATCAAAGCATTAAAACAATAATCAGCACACATCGAGGACTACTTCAATCATTCGAATTCCAGGTAACACAGGCACATAGCAA
ATAGTTCAACAGACATGCCTGGAGGTTCAGCCACAGAACGAAGGTAGCAAAATTTGACGGTGCAAACAGATACTATCAAGGTAAGCATAGGGCAGGTTCC
ACAGAACATAACAGCACATAAGCTTAACGGTAGCGGCGGAGGGAGACGGTCTGGTTCCTCTTCCAGGTGGCTCTCCTTGAGGGCCTGTTCTTGTGGTGGC
GGTGACCCTTGCCACGCAGACCACGGAATTTCTTTCCCGCAGAGGTGAGACCACGCAGCTCACGGTGCTTGTGCACAGGCTTGCAGAGCCAGTTGATCCT
TGGATCGTTGCGGACAGCGCTGTGAGCAACGTCAACAAGGATGACCTCAAAGTACTTGTAGGTGGAGTCCTCATTCACCCAGTAGGAGTTGAGGACACGA
AGACCACCAAGCCTGCGCCCAGCTCTTTCCTCAGCAACAGACCTCTTGTTCCTCTGGAACTTGAGTTGGGTAATACCCTGGTGCTTAGGCTTGCCATAAA
CAATACCCTTGGGCACTGGGCGCTTCCTGCCACCACGTCTCACACGGATACGGTAGACCACATACCCCTGCTTGGCCTTGAAGCCGAGACGGCGTGCCCT
GTCGGGGCGGGTGGGCCTGGTGATGCGGACGATGGCGGGCTGCTGCCTGTACTCCCAGCAACGCACGCGCTGCACGAACCTCATCACGTCGGACTGCTTC
CTCCTCCATAGCTCCGACACGAACTTGTACGCGCCCATGGCTGCGGCTGCGGCGGCAGAGGGCGGAGGCGGCGGGAAACGG
page-top