Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8863  (registered. 2012)
Contig Information
Length 1018 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115445329|ref|NP_001046444.1|| Os02g0250400 [Oryza sativa (japonica cultivar-group)]
Score 493
Evalue 1.00E-137
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8863
TTTTTTTTTTATTTCCCAGAGGCAATATTCGTAATCATGGTGTTCATTACATTTTACATTTATACCACCTCACAGATAAAACAAATCATGCTTTTGGTAT
CCCCTATTTCACCTTTGTACCCCACTTGCAATGAATTCAATCAAATGAAAATATACACGTATGAACCATTGGAACTATATGGAAGAACTACTTTCCCTTC
TCCAGTTTAGTGTGCTATTCTCAGACGCTCTACAAGTGCAACAGCAGAGGTGGAATGCTCACGAGGACTGAACAATCGGTTGGTCTGCGAAAGGGCCATA
TAGCCAACCCCTGGCGATATGACCGTAAGCAGCCTCCGTCAAGTGAATACCGTCCCAGCTCCAATGGGTCGTTGGGTCAGCACAAGCAGTGGCACCAGGC
TCCCCGCATTTGGCTGTCACGTTGAAGTTGTAAGCGGCTTTGGCAACGGACCCAGGAGCCCCACAGCATGCCCTAGGTAACTGCTTGTAGAATCCAAACT
TCTCAGGCTGGAGCATGAACTGGACAACTGGCGTGTAGTAGTCGCCATATATGATCCGCACATTGGGGTACTTGGGCCGGAGCTTCTCGAGTGCTCTCTT
GAGGTGTGCGTTGTGCACCCATGAGAAGGTGTTGTACTGACGGATGCACCCGCTCCGGGCGCCATACTCGTGGGCTGGCATGTCGAGCATGTTCAGGTAC
ACGGGGAAGCACCCAGTGGGCATCACCCCTGGCACGATGAGATCCACTGCCCCCTCGGCGATCAATTCCTCGACGCCATCGGAGATGCCCTGGATGACAT
CCGGCATGAACTTGTACGCCTCTGTGAGGCCCTTCCCGGCAAACAGGGGCGCGTTGTAGTCGTTGCCACCGAACTCGCCGACGACGAACAGCGAGTTGGC
ATAGAACTCCTTGCATTCTTCCTTGGTGGAGTTGCAGAAGAAAGGCTTGAGGTCACGGAACCACTGGATTTGGGTCATGAGGGCGCCGGAGTTCCAGACG
ACGGCGCCGAGGCCCCTG
page-top