Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8862  (registered. 2012)
Contig Information
Length 1524 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 6
WH_XB Root 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|60100234|gb|AAX13286.1|| DREB transcription factor 5A [Triticum aestivum]
Score 652
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8862
TTTTTTTTTTGCATTTTCACATTTTCTTTTTCCACCTTCCAAAGATCGTGATGCACAATCAAGGTTTCTTATCACAAGAAACATCGAAACAGAGAAGAGT
TCCCATGCCTAACAGAACTACAAACGAAGCACAAAAAACTAGCTTAGGAGCTTATTAGTTCTGCAGAGGAATCCAATCCGGTCGACCATTTGATCTTCAT
TGGAGCGCAGCAGCGGACACCGAAGGGCAAGCCGACCAAACACCATAGACATGGTTTGGCCGCCGGTAGGGGATCACAACCCTTCGAAGAACTCGCTCAT
CTCAGCATCATGGAAGGCAGAGTTGTGCATGGCCCGATCCTCTGATATCCACATTGGGTAAGGATAATCAGACTGCAGCATGCCCTCCAGCATGCCTTGG
TCCAAGCCATCCAGGTAGAGAGGTTCCTGCTGGCCCATCTCCACGCCAGTGTTGGCTCCACCATTCCAGGAGCCCCCAGTGACCAGCTCGACTTCAATTG
GGTCGGCTTCCATCAATCTCAATAATTCTTCTATATCAAAACCGTCTGCTTCTCCATCCGGCAAACTGGAAATAGGCTCCAATGGCTCGAACACATCCTC
TTCGGATGTGCTCCTTGAAATGCTTGAGCCAGCGTCAGGAACAGTGTCTTGATGGCTGTAATGCTCGACAGACTCCAGCACAACTGATTCTGTGGACTCA
AGCGCATCTGGCTGGGAGTAAATCTCAGGAGCTTGAGCTTGTCTCGGCAAGGAAGAAGCAACATCTGAGTGGTTGGTGGACGTTGTAGTAGACTCGCATG
ATGCTGAAGCACCACGTACAACACCTTCGATTGCCGCTGGTACAGCCACAGCAGGAGCTTGTGCAGGATGCACAGGGAAGTTGGTACGAGCCAGTGCGCC
ATACATTGCTCTGGCTGCCTCGTCATAAGCACGGGCAGCATCCTCAGCAGTGGGGAACGTTCCCAGCCAGAGCCTGCTCACCCGATTTGGCTCCCGAATT
TCAGCAACCCACTTCCCCCAAGTACGTTGCCTTACACCACGGAATCCACATTGTGTATTCTCAGGTCCTCCTTTCCCCAGCATACAGCCCTTCTTCGAAC
CCTTTGCAGGTGGCTTCCTCGCCCTCTTTGCACCCTGTGGATCATGCTCCAGTTGTTGGTTCACTTCTTTCCATCGCCTGATCGTTTCAGAGACTGAATT
AGGCCCATCACGTGATCTCCGAGGTCGCTTTTTCCTATTGAATAGATGCCACTGGCGGCGCATCTCCCTTGGGGTTTTGCCGCGCCAAGAGTACATATTC
ATTACAGGGAAGATTACTGCTTCCTATTGGTTTGACGAGAACATGACTCCGGGTACTTTCCTCTGCTCCACAAGTTCTTCCAGGCTGGAGCGCCGGGATC
TCGAAGGGCGCCGCCGCCGCCGCCTCGGCGTGCTTCCGATCTACCGTCATGGCCGACCCGATCCGGATCGGGTCCAGATATCTAGCGTTCGCAATCTTGT
CGCCTGTTTTCTTCGCTGCGTCGA
page-top