Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8848  (registered. 2012)
Contig Information
Length 669 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 6
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 2
WH_XB Root 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218202406|gb|EEC84833.1|| hypothetical protein OsI_31924 [Oryza sativa Indica Group]
Score 259
Evalue 2.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8848
TTTTTTTTTTACTCAAATTTCAAGTGCATACTTCAAGACGTTTGCGTAATTCAACTTTTTTTTTTGACAAAACCAGATAGTACATTTCACCATTGCTCAC
ACCAAAAAGGCAGTTCATACATGAAATCTTGCAAAATGGCAGTATTTTTCTTCTCAAACAGGGATGTAACGTCTACTACAAAGGTAGCAACCAAGACTAG
TTGACTAGATAATGCTTTACTCGTCCTCCTGGCTGCGGAGCCTGGCAAGCTTGTTGGTGACCACGACATCCAGCTGCGCAGCACGCTCAACGATCGCCTT
GCGCTTCTGTGTGGACACATTGTGTGCGATCTCGGCACAGTAGGTCCTGTTGTGCATCATAAGCAGCTCCAGCTCAGAGACATTGTGGACAACGAACTTC
TTGAACTTGTTGGGCAGGTAGTGCCTGGTCTTCTTGTCTGAACCGTACCCAATGTTGGGCATCAAGGTGCATCCCTTGAACTTCCGCCTGACGCGGGAGT
CGATACCCTTTGGCCTACGCCAGCTTTGCTTGAGGCCGATGTAGCGGTCGCTGTGCGCCCTCTTGAAGTGCTTCACCCTCTTCTTCACGATCGCCTTCTT
CAGCAGAGGCACCGCCATCTTGGGAGAACTGCGGCGGAGCGGGCGGGCGGGCGGGCGGCGGCGGCGGCG
page-top