Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8829  (registered. 2012)
Contig Information
Length 914 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226533216|ref|NP_001150530.1|| heavy metal-associated domain containing protein [Zea mays]
Score 218
Evalue 6.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8829
TTTTTTTTTTATGACACCCGAGTTTCCTTTTATTCATTCCTCCTGTACAATCTGTTACCACGCTCCAAGCCACCATCGCTGATCCAAGCAACCTGTACTG
TACATACGTACCACTGAGTGCTCAGGCAGCCAACATCTCTCTGCTCTCTGAGCCAACATCTGGTCAGGCCATCAATCATGGCCTAAACACAGCTCGCAAC
TCTCCGGCCGGGTCTCGCCGGCGCATCATCTCTCCCTAATGAATAACTATACTACTACATCTACATAATGCTGCAGCCGGGATCCTGTTCTTGCTGCTGA
TAAGCCGGAGCAGGGTAGGAGTAAACCGGGTAGGACGGCATGGAGTTGTACTGCTGGTACGCGGGGTACGTCATCGGCGCAACCGTGTTCTGAGAGTAGC
CGCCGCCTCCGCCGCCGCTGCCACCACCTTTGGAACCGCCACCCTCCTTGCCACCGAAGCTCATGCCGCTACCGCCACCGTCGCCGCCGCCGTACCCGTA
GCCGTCCTTCTTCTTCTCGCCGCCGCCGTACCCGTAGGCTGCGGCGTAGCCGTCCTTCTTCTCGCCGCCGCCGTACCCGTAGGCGGCGCCGTAGCCGTCC
TTCTTCTTGTCGTCGCCGGACGACACGCTGAGGAGCTCTGCGTAGCCCAGGCTGCGCCGGAGCATCGTGGTCAGCGTGATCGGGTCGACGCCGTCCCCGA
CGATGATGATCTTGTCCCCCTCCATCGTCGCGGATGTCACGCCTGACATGCCAACGGCCGCCTTGAAGGCCTTCCTCCTCTTCCTCTCATCATCCAGAGC
CAACTTGAGGACAATCTTTTGCTTAACCATCTTGCAACTCGCACAAACTCTCACGGAATCTCCAGCTAGCTTTGACAGTACACTAGCAGAGTAGCTAGCT
ACTCCAGAAGATCA
page-top