Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9285  (registered. 2007)
Contig Information
Length 713 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_r Root 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_007774 [Oryza sativa (japonica cultivar-group)]
Score 294
Evalue 6.3646e-25
Total Hit Count 47
Registered year 2007
Contig Sequence     [ Download ]
>Contig9285
gaggaattcggcacgagggaaagcctgccgccgagaagccgaaagctaccacCATCaggaagAGGGCGCCGGCTCAGAGCAAAGGGATGAAGCAGAAAGT
GATGGAGGAAATACTCAAGCCTACTGATGACAGCAACCTCAGCGCGCCTTCTCCTGAGAAGAAGGTGCGGAGGATCAGGTCCTCCCCCTTCAACAAGAAG
AGCGGCTCGCTTCTGCAga*gggcGGCGGGCGCTTCAACGGGGGCAGAGGATGCCGAGGCTCCTCCCTCCGGcatgcTCTGCCGAGCCAGTTGCACCGAG
AAGGACAGTAAGGGAGAGGAAGGTGGCGATAGTCTACGCCGATTCCGGGAGCGACGACGTTGAGGAGTCTGAGGATGAAGATGCGTCGGAGCCGAGCGAA
TCTGACTACTCCGATGAGGACTAGAGTGCTGGACTCCTTGGCTCAGCTGCCCAAACAGTGTGTGGAATTGGAGTGCAGTGTGACTGGTTTCTAAGACATT
TGGTTAGCTGATCTGATGTGTTGGTGCATTTCTTGTGCGTCTTATGTTTATGTTAGATGTGTGTACTGAGGTC*ACAAGAAGGTTTGGAAGC*TATGTGT
TGTTTGCTTACAGTTTCTCCATGGCTTCTGTTCCTACTTAGTCTGTGAGCTTGTATCGTTGTTCAGTCTATCAATACTGAGAGTTTATTAtatctgtctt
aaaaaaaaagggg
page-top