Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9215  (registered. 2007)
Contig Information
Length 443 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Wheatwin-1; AltName: Full=Pathogenesis-related protein 4a; AltName: Full=Protein 0.14; Flags: Precursor >gi|3135957|emb|CAA06856.1| wheatwin1 [Triticum aestivum]
Score 290
Evalue 2.00439e-36
Total Hit Count 87
Registered year 2007
Contig Sequence     [ Download ]
>Contig9215
gggaCGGCGTTCTGCGGCCCCGCCGGCGCCCACGGGCAGGCGTCCTGCGGCAAGTGCCTCCAGGTGACCAacccaggcGACGGGGGCGCAGATCACGGCG
AGGATCGTGGACCAGTGCGCCAACGGCGGGCTGGACCTGGACTGGGACACCGTCTTCACCAAGATCGACACCAACGGGATCGGGTACCAGCAGGGCCACC
TCAACGTCAACTACCAGTTCGTCGACTGCCGCGACTAGATTACGTTCTCCGTCGATCGATCAAAGGGCTAGCTAGCTATGATAAGAATAAAAGGCTAGCT
AAAAGTAAGTTGAGACTGATCCATGCTGTTAAATAAAAGCTAGCACGTGATGCTGCATTGTATACGTGTTACGTGTATACAGTACGTACATGGAACGAAA
TAAAGTGGAACAGACcaaacgggttatctattcaaaaaaaaaa
page-top