Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9185  (registered. 2007)
Contig Information
Length 628 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Polcalcin Phl p 7 (Calcium-binding pollen allergen Phl p 7) (P7) >gi|30749366|pdb|1K9U|A Chain A, Crystal Structure Of The Calcium-Binding Pollen Allergen Phl P 7 (Polcalcin) At 1.75 Angstroem >gi|30749367|pdb|1K9U|B Chain B, Crystal Structure Of The Calcium-Binding Pollen Allergen Phl P 7 (Polcalcin) At 1.75 Angstroem >gi|3367732|emb|CAA76887.1| p7 protein [Phleum pratense]
Score 392
Evalue 2.09177e-36
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig9185
ttcggcacgaggcGCCCGTCC*CCGATCgaagagTGATTCGAGGTAGAGGAACTACAAGGGGCCGATAATGGCGGACGACATGGAGAGGATCTTCAAGAG
GTTCGACACGAACGGCGACGGGAAGATCTCGCTGACTGAGCTGACGGACGCGCTGCGGACGCTGGGGTCGACCTCCGCGGACGAGGTGCAGCGCATGATG
GCAGAGATCGACACCGACGGTGACGGCTTCATCGACTTCAGCGAGTTCATCTCCTTCTGCAACGCCAACCCGGGGCTCATGAAGGACGTCGCCAAGGTCT
TCTGAATCAGTTCATTTCACCTCAGCCGTCCGTTCCAGGAGCCGATCCATCTACGTACGGCTTCGTATATCAATTTCATGCAACTACCTACTCCGGTCCC
GATCCAGCCTCAGCTTCACCTGAGGCCGGCCCTAAATTTGTTTGATCAATTCTTTTGCTACTAGTAGTAACTAGTGATGATCACTGTTGCATCATTTATT
TATTTATTTTATATATCATCACAAGTTTCCTGTGATTCTTTTCTTTCTATACCTTTTTGTCGATCGTCGGCTCCAGCTCGATCGAACGATCCATGCTGCt
aattgtttgtgtacgggnnattaagtaa
page-top