Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9112  (registered. 2007)
Contig Information
Length 690 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein kinase Pti1 [Glycine max]
Score 593
Evalue 1.28593e-59
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig9112
aaagacgcctcgagttttggacatttccgatatgcacttccaataaagagcacagataaccactgaccacctatataacagacaaatgtacatcacaaat
ctcaaacagcagaaaatccctagggtggcagcaacagactggcagagaaaatATTATGTATCCGACTGAAGAATCCCGGAAAACAAATCTACAAACCGCT
CGCAAATCACACCCGGTGTGCCAGCCATTTCGGGCTAGTAAGCGCTGGGAAGTCTCATGATCCAGCACCTCCTAAGCCCCGGGTGCCGGGGCCAGCTCCG
AGGCTGCCGGGGCTGCTGCTCTTTGTTGTAGCAGAGGAGAGAGCGCCTTGACGACGATGCTCATGTTGGGCCTGAACTCTGCTTCATACTGCACGCACAG
AGCTGCCACCGCACCAAGCTTAGCAACTCCCTTTGGAGGATATTCTCCCTTCAACCGAGGATCTACGCATTGCTTCACCTTATCTTCACTCAATCTTGGA
GTAGCCCAAGTGACTAAACTTTGCTGCCCCCGAGGCATTGTGTGATCGaccggtttccttccagtcagaagttcaagaagaaccacgccaaagctgtaga
cgtcactcttctgtgtcagctggccagtcatagcatattctggcgcatgatatccaaatgtccctaatacacgagtcgaatggagacgtg
page-top